ID: 1154197657

View in Genome Browser
Species Human (GRCh38)
Location 18:12278401-12278423
Sequence CTGCAGGCACAGCTGGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154197652_1154197657 4 Left 1154197652 18:12278374-12278396 CCTCCTGTCCGTGGCTGGGATCT No data
Right 1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG No data
1154197654_1154197657 -4 Left 1154197654 18:12278382-12278404 CCGTGGCTGGGATCTCTAGCTGC No data
Right 1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG No data
1154197653_1154197657 1 Left 1154197653 18:12278377-12278399 CCTGTCCGTGGCTGGGATCTCTA No data
Right 1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG No data
1154197647_1154197657 30 Left 1154197647 18:12278348-12278370 CCTCATGCTGGCTCAGCTGCGAG No data
Right 1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154197657 Original CRISPR CTGCAGGCACAGCTGGACGA AGG Intergenic
No off target data available for this crispr