ID: 1154200946

View in Genome Browser
Species Human (GRCh38)
Location 18:12300281-12300303
Sequence CAGAGCTTTCTCATTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154200946_1154200951 19 Left 1154200946 18:12300281-12300303 CCTCTTTGAATGAGAAAGCTCTG No data
Right 1154200951 18:12300323-12300345 ATCCACTCTTGCAGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154200946 Original CRISPR CAGAGCTTTCTCATTCAAAG AGG (reversed) Intergenic
No off target data available for this crispr