ID: 1154203549

View in Genome Browser
Species Human (GRCh38)
Location 18:12317954-12317976
Sequence CTATAAATATTGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154203545_1154203549 17 Left 1154203545 18:12317914-12317936 CCTTTCATCAAGAGCACAGAAAA 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 216
1154203543_1154203549 27 Left 1154203543 18:12317904-12317926 CCAGCTTCCTCCTTTCATCAAGA 0: 1
1: 0
2: 0
3: 20
4: 299
Right 1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 216
1154203544_1154203549 20 Left 1154203544 18:12317911-12317933 CCTCCTTTCATCAAGAGCACAGA 0: 1
1: 0
2: 2
3: 27
4: 170
Right 1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154203549 Original CRISPR CTATAAATATTGAGGAAGCT GGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901487148 1:9572059-9572081 CTATAAATATTCAGACAGGTTGG - Intronic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
908822276 1:68100945-68100967 CAATAAATATTTAGGAAGTGGGG - Intronic
909429335 1:75568892-75568914 ATATAAATATTGATGGAGATTGG - Intronic
911810591 1:102272962-102272984 CTGTAAAAATTGAAGAGGCTGGG - Intergenic
913003937 1:114609596-114609618 CTCTAAATTTTGAGCAATCTGGG + Intronic
916669677 1:167003243-167003265 GTATAAAGATTCAGGAAGCCAGG - Intronic
916958115 1:169861414-169861436 CCATGAATTTTCAGGAAGCTTGG - Intronic
922681944 1:227606179-227606201 CAATAAATACTGAGGGAACTCGG - Intronic
922985267 1:229861464-229861486 CTATAACTATGTAGGAAGCCGGG - Intergenic
923726439 1:236509721-236509743 CCATAGATGATGAGGAAGCTGGG - Intergenic
924540242 1:244973791-244973813 CTCTAAATATTGAAGAAGAGTGG - Intronic
1064012489 10:11745696-11745718 CAAAAAAGATTGAGGAAGGTAGG + Intronic
1065762525 10:28995438-28995460 ATGTAAATATTGAAGAAGCATGG - Intergenic
1065798368 10:29328270-29328292 CTGTAGACATTCAGGAAGCTTGG + Intergenic
1066036623 10:31494867-31494889 CTATAAATGTAGAGGTAGCAAGG + Intronic
1066251964 10:33642205-33642227 TTATAATTATTGATTAAGCTAGG + Intergenic
1066718095 10:38308245-38308267 CTTGAAATCTGGAGGAAGCTGGG - Intergenic
1066718099 10:38308268-38308290 CTTGAAATCTGGAGGAAGCTGGG - Intergenic
1067345924 10:45439281-45439303 CTATAAGTATTGTGGAAGGTGGG - Intronic
1068388617 10:56362554-56362576 CTATAAATACTGCTGAAGTTTGG - Intergenic
1068623929 10:59218734-59218756 TTATAAATATTGAGTGATCTTGG + Intronic
1068726945 10:60313690-60313712 CTGTAAATATTGAGGATGTTAGG - Intronic
1069869908 10:71526795-71526817 CTTTTAAAAATGAGGAAGCTGGG + Intronic
1070093218 10:73309951-73309973 ATAAAAATTTTTAGGAAGCTGGG - Intronic
1070204614 10:74244154-74244176 CTATAAATAGTGAAGTAGCTTGG - Intronic
1071847166 10:89532814-89532836 CTATGAATATGGAGGAAAGTGGG + Intronic
1072396049 10:95042718-95042740 CTATAAAGATTTATAAAGCTAGG - Intronic
1075287108 10:121196396-121196418 CTAGAAAGATGGAGGAAGCTTGG - Intergenic
1078072638 11:8127354-8127376 CTAGAGAAATTGAGGAAACTGGG + Intronic
1079675513 11:23221455-23221477 CCACAAATATTGATGAGGCTTGG - Intergenic
1080300431 11:30778597-30778619 CAATAAATCTTGAGGGAGGTTGG - Intergenic
1082030986 11:47603315-47603337 ATACAAATAATGAAGAAGCTGGG - Intergenic
1082037164 11:47654298-47654320 CTTTAAATATGGAAGAAGCCTGG + Intergenic
1083020885 11:59505728-59505750 CTATCAAGATTGATGAGGCTTGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085009637 11:73129371-73129393 CTGTAAGTATGGACGAAGCTTGG - Intronic
1085664680 11:78403557-78403579 TTTTAAATATTGAGAAAGATAGG - Intronic
1086269634 11:85046067-85046089 CTAATAATATGGAGGAAGCAGGG - Intronic
1087639541 11:100741563-100741585 CTATACAGGGTGAGGAAGCTAGG - Intronic
1088475051 11:110227524-110227546 CTACAAACATGGAGGAATCTGGG + Intronic
1088560350 11:111108988-111109010 CATTAAATATTGAGGAATCAAGG + Intergenic
1090319795 11:125832362-125832384 CTGAAAATGTTGAAGAAGCTTGG - Intergenic
1095227862 12:39698670-39698692 CTAGAAATAATGAGGAATTTTGG + Intronic
1095666239 12:44802299-44802321 CTATAAATATTGAAAAAACAAGG + Intronic
1095994647 12:48070550-48070572 GTATAAATATTGAGGATAATAGG - Intronic
1096649559 12:53055294-53055316 CTATTAATAACGAGGAAGCTGGG - Intronic
1098866541 12:75770325-75770347 TTATAAATATTGAGAAACTTGGG - Intergenic
1099111374 12:78565896-78565918 CTATACATACTGATGTAGCTTGG - Intergenic
1099959393 12:89381888-89381910 CTATAAAAATTGATCAAGCTGGG + Intergenic
1100638113 12:96455495-96455517 GTAACAAGATTGAGGAAGCTAGG - Intergenic
1102484587 12:113247222-113247244 GTATTCATTTTGAGGAAGCTGGG + Intronic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1103622367 12:122195750-122195772 ATCTATATATTGAAGAAGCTTGG - Intronic
1103918511 12:124387978-124388000 CAATAAATAAGGAGGTAGCTAGG + Intronic
1107299087 13:38946943-38946965 CTAGAACAAGTGAGGAAGCTTGG - Intergenic
1108000988 13:45905675-45905697 CTATAAATATTGAATCACCTAGG - Intergenic
1108228276 13:48312994-48313016 CTACAAATACTGAGAAAGTTTGG - Intronic
1109149010 13:58820883-58820905 ATAAAAATATTGAGGAAATTTGG - Intergenic
1110023327 13:70503906-70503928 ATGTGAATATTGGGGAAGCTGGG + Intergenic
1110286815 13:73759389-73759411 CTATAAATAATGAGCATGCAAGG + Intronic
1112840281 13:103567484-103567506 GTATAAATATTAAGGAAGCAAGG + Intergenic
1112909771 13:104467447-104467469 CTATACATAATGAGAAATCTTGG + Intergenic
1114649934 14:24278072-24278094 TTATAAAGAATCAGGAAGCTGGG - Intergenic
1116269709 14:42746039-42746061 TTATGAATATTGTGGAAGATGGG - Intergenic
1116413813 14:44656675-44656697 CAATAAATAATTAGCAAGCTAGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118367461 14:65108070-65108092 CAAGAAATATTAAGGAGGCTGGG + Intergenic
1120414151 14:84198078-84198100 CTATAAATATTAAGAAAAATAGG - Intergenic
1120538497 14:85726626-85726648 CTAAAAATATTGAGTAAGTTGGG + Intergenic
1121749177 14:96333229-96333251 CTATAAATGTAAAGTAAGCTGGG + Intronic
1124074269 15:26428120-26428142 TTATAAATATTGAGAAAAATTGG - Intergenic
1125067669 15:35509918-35509940 CTTTAAAGATTCAGGTAGCTGGG + Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1126080554 15:44957051-44957073 TAATAAATATTGATGAGGCTGGG + Intronic
1126741678 15:51783186-51783208 ATAGAAATATTGAAGTAGCTGGG + Intronic
1127690846 15:61395877-61395899 CTATTAATATTAAGGATCCTAGG - Intergenic
1129628222 15:77228834-77228856 CTAAAAGTATTGAGGACTCTAGG + Intronic
1131037407 15:89232187-89232209 CTATAAATAATCAGCAAACTGGG - Intergenic
1131708920 15:95031589-95031611 CTTTCAATATTAAGGAAGTTTGG + Intergenic
1133790261 16:9004170-9004192 CTAAAAATATTGAGGGACCTAGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134604347 16:15558416-15558438 CTATGAAGATCCAGGAAGCTTGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141383057 16:83593082-83593104 CTATAAATATTGCAAAAGATTGG - Intronic
1144623968 17:16835039-16835061 CAATAAATACTGAGGGAACTCGG - Intergenic
1144882457 17:18437677-18437699 CAATAAATACTGAGGGAACTCGG + Intergenic
1145149777 17:20506709-20506731 CAATAAATACTGAGGGAACTCGG - Intergenic
1146146150 17:30418428-30418450 CAATAAATATTTTGGAAGCCTGG - Intronic
1146648520 17:34591605-34591627 TTAAAAATAGTGAGGAAGCCTGG - Intronic
1146737326 17:35249960-35249982 CTATGGATATTGGGGAAGTTTGG - Intronic
1149785770 17:59433702-59433724 CAATATAAAATGAGGAAGCTGGG + Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150680709 17:67282072-67282094 CTTTAAATATTGAGTCAGCAAGG + Intergenic
1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156814485 18:41293389-41293411 CTATAGAAATTAAGGAAGTTGGG + Intergenic
1158531317 18:58264930-58264952 ATATAAATACTTAGGGAGCTTGG + Intronic
1158578751 18:58662863-58662885 CCAAAAATATAGAAGAAGCTGGG + Intergenic
1165949655 19:39466921-39466943 CTATAAAGATTGATGAGGCTGGG + Intronic
1166625366 19:44347372-44347394 CTATAATTATTGATATAGCTGGG + Intronic
1168486169 19:56764230-56764252 TTATAAATATTCAGGAATGTTGG - Intergenic
925201951 2:1974599-1974621 CCAAAAATGTTGAGTAAGCTTGG + Intronic
925533823 2:4894454-4894476 CTAAAAATATGGAAGTAGCTGGG - Intergenic
926463413 2:13162041-13162063 CTATAAATATAGAGGAAATGGGG + Intergenic
930491521 2:52078956-52078978 CTAAAAATATTAAGGCAGATTGG - Intergenic
931257773 2:60588718-60588740 TTCTAGATATTCAGGAAGCTAGG - Intergenic
932481707 2:72043771-72043793 CTATAAGTATTGAGCAAGCTAGG - Intergenic
932530960 2:72532061-72532083 TTATAAATATTGAAGAACATTGG - Intronic
935353265 2:102174119-102174141 CAATAATTAAAGAGGAAGCTGGG - Intronic
935556145 2:104511679-104511701 TTATACATATTGAGGAAAATTGG - Intergenic
935610462 2:105018614-105018636 ATATAAATATTCAAGAAACTTGG + Intergenic
938135065 2:128750064-128750086 CTCTCAATATTAAGGGAGCTGGG + Intergenic
938647171 2:133343802-133343824 GTATAAATGTTGAACAAGCTTGG + Intronic
939476616 2:142695257-142695279 CAATAAATACTGAGGGAACTCGG - Intergenic
939908269 2:147946156-147946178 CTATAAATAAAGAGGATGCTGGG - Intronic
941859228 2:170261848-170261870 ATATAAATGTTCAGGAAGATTGG + Intronic
942632645 2:177967822-177967844 CCATAACAATTGTGGAAGCTAGG + Intronic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
945299823 2:208205849-208205871 CTATACATATTCATGAAGCTTGG + Intergenic
946682591 2:222232835-222232857 CTATAAATATATAGGAATCTGGG - Intronic
947925297 2:233916083-233916105 TTAGAAATATTGAGCCAGCTGGG - Intergenic
1169528807 20:6461328-6461350 CTATAGAAATTCAGGAAGCGTGG + Intergenic
1171566810 20:26201708-26201730 TTAAAAATATTGAGAAAGATTGG - Intergenic
1173351657 20:42251119-42251141 CTATCAATATTGAGGAAATTTGG - Intronic
1173471744 20:43329257-43329279 CTATAATAATTGTTGAAGCTGGG - Intergenic
1177497459 21:21908413-21908435 CAATTAATATTGAAGAATCTGGG + Intergenic
1177705236 21:24695626-24695648 TTCTAAATATTGAGAAAACTTGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178895668 21:36554928-36554950 CTATAAATATGGAAGAATTTGGG - Intronic
1179111801 21:38453308-38453330 CTAGAAATATTGTGAAAGATTGG + Intronic
1180016528 21:45089233-45089255 CTATGATTTTAGAGGAAGCTGGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182082471 22:27539009-27539031 CGATATATATTTAGGAGGCTGGG - Intergenic
1182387265 22:29955148-29955170 CTATAAAAATTTAAAAAGCTGGG - Intronic
1183835662 22:40450751-40450773 CTTTGAAAATTGAGGAGGCTGGG - Intronic
949118047 3:352825-352847 TGATAAATATTGGGGGAGCTTGG + Intronic
949226591 3:1702223-1702245 CTAAAAACAATGAGAAAGCTTGG - Intergenic
952905324 3:38136332-38136354 CAATAAATACTGAGGGAACTCGG + Intronic
953225124 3:41011591-41011613 TTAAAATTATTGAGGAAGATGGG + Intergenic
953299709 3:41760723-41760745 ATATAAATAATGAGAAATCTTGG - Intronic
955580267 3:60412268-60412290 ATAAAAATCTTGAGGAAGGTGGG + Intronic
955715360 3:61823829-61823851 TTATAAATGATGATGAAGCTGGG + Intronic
956204063 3:66738075-66738097 CTGTAAATATTGAGAAGGGTGGG + Intergenic
956722046 3:72126578-72126600 CTTTAAAAATTGGGGAAGCTTGG + Intergenic
958116380 3:89224305-89224327 CTTTAAATATTGAGGTTGCCAGG + Intronic
959144549 3:102529152-102529174 CTATAAATATAAGGAAAGCTGGG - Intergenic
961150034 3:124630014-124630036 CTACCAGTATTGAGAAAGCTGGG - Intronic
963589636 3:147241820-147241842 CTATAAAAATTTAGGACCCTTGG + Intergenic
964935442 3:162079550-162079572 CTATCTATATTTAGGAAGATTGG + Intergenic
964951832 3:162304991-162305013 GTATAAATACTGTGGTAGCTGGG - Intergenic
965218033 3:165890351-165890373 CTATAAATATTAGTGTAGCTAGG + Intergenic
965639429 3:170816978-170817000 TTATAAATATTGATGAAGAATGG - Intronic
966838297 3:184066870-184066892 TTAAAAATATGGAGGAAGCCTGG - Intergenic
967318514 3:188173167-188173189 CTCTAAATATTAAGGAATATGGG - Intronic
968231316 3:197006437-197006459 CTAGAGAAATTGAGGAAGCCCGG - Intronic
970708862 4:18838586-18838608 CTATACATATTATGGAAGTTTGG + Intergenic
970836545 4:20415438-20415460 TTATAAATATTTAGAATGCTGGG + Intronic
973684655 4:53356959-53356981 CTATTAATATTAATGAAGGTAGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975071462 4:70144871-70144893 CTATAAAAATTCTGGAAGATTGG + Intronic
977393096 4:96438128-96438150 CTATAAATATATAGAAAGCAGGG + Intergenic
977697767 4:99985874-99985896 CTAAAAAAGTTGAGGAGGCTGGG + Intergenic
979023294 4:115531282-115531304 TTATAAATGTTGAGGAAGTCTGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983983904 4:174034815-174034837 TTAGAAATATTAAGAAAGCTAGG + Intergenic
988011509 5:25493182-25493204 CTTTAAAGATTGAGGAGGTTTGG - Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989299089 5:39867704-39867726 CTATAAAAATAGAGCAAGTTAGG + Intergenic
989325891 5:40194038-40194060 TTATAAAAATTGAAAAAGCTGGG - Intergenic
990662406 5:58030976-58030998 CCATAAAAATTGAGGAAGTTGGG - Intergenic
990852869 5:60227117-60227139 CTTTAAATATTCAAGAAGTTAGG - Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
991699803 5:69306834-69306856 TTAAAAATATAGAGGAATCTTGG - Exonic
992575367 5:78104527-78104549 TTATAAATATTGAAGAATATTGG - Intronic
992656009 5:78910183-78910205 CAATAAATACTGAGGAAACCCGG + Intronic
993100294 5:83530284-83530306 CTATAAATATGCAAGAAGCTAGG - Intronic
994539894 5:101081116-101081138 CCATAAATATTCAGCAAACTAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
999512579 5:152268132-152268154 CAATAAACATTGAAGAAGTTGGG + Intergenic
1000200124 5:159001014-159001036 CTATATATATTTATGAAGCTGGG + Intronic
1000440789 5:161260689-161260711 CTGTAAATAATGAGCAAGTTTGG + Intergenic
1001505453 5:172275857-172275879 CCAGGAATATTGAGGTAGCTTGG - Intronic
1001987535 5:176087632-176087654 CAAAAAATACTGAGGAAGGTGGG - Intronic
1004253068 6:14038200-14038222 CCCTACATAGTGAGGAAGCTGGG + Intergenic
1007063510 6:38965258-38965280 ATATAAATATTCAGGAAGATAGG + Intronic
1007870800 6:45035576-45035598 ATATAAATATTGATGGAGGTAGG - Intronic
1008200201 6:48577749-48577771 ATATTAATATTGAGGAATCAAGG + Intergenic
1008318471 6:50076963-50076985 CTAAAAATAATGATGAACCTGGG - Intergenic
1008903423 6:56649212-56649234 CTTTAAAAATGGAGGAAACTTGG + Intronic
1009716508 6:67404717-67404739 CAATAGATGTTGGGGAAGCTTGG - Intergenic
1009788463 6:68368503-68368525 GTATAAATATTAAGGAGGCCAGG + Intergenic
1012468175 6:99538668-99538690 CTATATATAATGAGATAGCTTGG + Intergenic
1012822635 6:104106043-104106065 CTCTAAATAATGAGGATGTTGGG + Intergenic
1015235070 6:130961654-130961676 CTTAAAACATTGAGGAAACTGGG + Intronic
1015840790 6:137474806-137474828 CTATAAATATCTAGCAAGTTTGG - Intergenic
1016002914 6:139060631-139060653 CTATAAGTATTGTGGGAACTAGG - Intergenic
1016571037 6:145512952-145512974 CTATAAAAATTCTGGAATCTGGG + Intronic
1017033387 6:150244454-150244476 GTATAAATAGAGAGGAAGATAGG - Intronic
1017457206 6:154612334-154612356 ATGTAAATATTGGAGAAGCTGGG - Intergenic
1018285431 6:162232428-162232450 CTATATTTAGTGAGGAAGATGGG - Intronic
1022334448 7:29409057-29409079 CTATAAAACTTGAGGAAAGTGGG - Intronic
1022921203 7:35016774-35016796 CCATAAATGTTCAGGAAACTTGG + Intronic
1023718682 7:43071383-43071405 TTTAAAATATTGAGGGAGCTGGG + Intergenic
1024210253 7:47197246-47197268 CTACAAAAATTGAGTGAGCTGGG + Intergenic
1024839798 7:53573254-53573276 ATATAAATATTCAAAAAGCTTGG - Intergenic
1024932767 7:54680910-54680932 CTATTACTATGGAAGAAGCTTGG + Intergenic
1026417229 7:70194995-70195017 GTAGAAATATTGAGAAAGCCAGG - Intronic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027983956 7:85261477-85261499 CTATTAATACTGAGGAACCATGG + Intergenic
1030345321 7:108426784-108426806 CCATAAATATTGAGGGAAGTGGG + Intronic
1030482317 7:110120046-110120068 CTCCCAGTATTGAGGAAGCTGGG + Intergenic
1030665269 7:112270458-112270480 CTTTTAATAATGAGAAAGCTCGG + Intronic
1031183217 7:118443195-118443217 ATAAAATTATAGAGGAAGCTTGG - Intergenic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1032375081 7:131405835-131405857 TTATAAAAATTGAATAAGCTGGG - Intronic
1033236359 7:139640909-139640931 CTTTAAAAAATGAGGAAGCTGGG - Intronic
1033482015 7:141751921-141751943 CAATAAATACTGAGGGAACTCGG + Intronic
1033504860 7:141989716-141989738 CCATAAAAATTGAGGAATTTTGG - Intronic
1036002308 8:4621176-4621198 CTATAAATAATGAGAAATCCTGG + Intronic
1036818792 8:11922694-11922716 CCATTCTTATTGAGGAAGCTGGG - Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039929779 8:41974471-41974493 CTATCAATATTAAATAAGCTTGG - Intronic
1041091424 8:54304669-54304691 CTAGATATATTTAGGAAACTAGG - Intergenic
1042228949 8:66537798-66537820 CTATAAAAATTTAAGAAGTTAGG - Intergenic
1043474445 8:80592657-80592679 CAATAAAGAGTGAGGAAGGTAGG - Intergenic
1044818535 8:96138414-96138436 CTATAACTACTGAGGAAGCAGGG - Intergenic
1046175019 8:110564155-110564177 CTATAAGTATTAAGGAAACATGG - Intergenic
1046291600 8:112169419-112169441 CTATATTTATTTAGGGAGCTAGG + Intergenic
1046600494 8:116311671-116311693 GGATAAATAATGAGGGAGCTTGG - Intergenic
1050107296 9:2178797-2178819 CTATAGGTAATGTGGAAGCTAGG + Intronic
1052813162 9:33079209-33079231 CTATAAATAATGAACAAGCTTGG - Intergenic
1054759210 9:68989682-68989704 CTATAAAAATGGAGCAAGCTGGG + Intronic
1056289395 9:85127487-85127509 CTTTAAATATTGAGGTACCCAGG + Intergenic
1057352669 9:94313648-94313670 CTAAAAACATGGATGAAGCTTGG + Intergenic
1059837780 9:118176456-118176478 CTATAAATATAGAGAAAGCATGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186262436 X:7793611-7793633 CTATAAAGGTTGTGGAAGGTTGG + Intergenic
1188379167 X:29470432-29470454 CAATAACTATTGAGAAAGATAGG - Intronic
1189176256 X:38960335-38960357 CAAGAAATATTGAGAAAGCCTGG - Intergenic
1189822908 X:44887574-44887596 CTATTAATAATAAGGATGCTAGG + Intronic
1195010268 X:100726759-100726781 GTATATACATTGAAGAAGCTTGG - Intronic
1195404907 X:104502152-104502174 CTCTAAACTTTGAGGCAGCTGGG + Intergenic
1196047064 X:111267533-111267555 CTGGAAAGCTTGAGGAAGCTAGG + Intronic
1198878548 X:141253789-141253811 CAATAAATGGTCAGGAAGCTAGG - Intergenic