ID: 1154210774

View in Genome Browser
Species Human (GRCh38)
Location 18:12377106-12377128
Sequence CCGCGCCTGCGCAGCGTCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 7, 3: 19, 4: 163}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154210774_1154210784 9 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210784 18:12377138-12377160 GACTGGCGGCCTCGGGAAGCGGG 0: 1
1: 0
2: 0
3: 16
4: 165
1154210774_1154210790 26 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210790 18:12377155-12377177 AGCGGGCTCGGCTCGGGGAAAGG 0: 1
1: 0
2: 1
3: 4
4: 108
1154210774_1154210789 21 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210789 18:12377150-12377172 CGGGAAGCGGGCTCGGCTCGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
1154210774_1154210780 -5 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210780 18:12377124-12377146 CGCGGGCAGGCGACGACTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 63
1154210774_1154210783 8 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210783 18:12377137-12377159 CGACTGGCGGCCTCGGGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
1154210774_1154210781 1 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210781 18:12377130-12377152 CAGGCGACGACTGGCGGCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 94
1154210774_1154210785 14 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210785 18:12377143-12377165 GCGGCCTCGGGAAGCGGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 165
1154210774_1154210788 20 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210788 18:12377149-12377171 TCGGGAAGCGGGCTCGGCTCGGG 0: 1
1: 0
2: 1
3: 6
4: 80
1154210774_1154210779 -8 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210779 18:12377121-12377143 AGGCGCGGGCAGGCGACGACTGG 0: 1
1: 0
2: 0
3: 6
4: 88
1154210774_1154210787 19 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210787 18:12377148-12377170 CTCGGGAAGCGGGCTCGGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1154210774_1154210782 2 Left 1154210774 18:12377106-12377128 CCCGGGACGCTGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 19
4: 163
Right 1154210782 18:12377131-12377153 AGGCGACGACTGGCGGCCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154210774 Original CRISPR CCGCGCCTGCGCAGCGTCCC GGG (reversed) Exonic
900971592 1:5995026-5995048 CCGCACCTGGCCAGAGTCCCTGG - Intronic
901833557 1:11908908-11908930 CCCCGCCTGAGGAGCGTGCCAGG + Intergenic
902348301 1:15835263-15835285 CCGGGCCTGAGGGGCGTCCCGGG - Intergenic
903043939 1:20552409-20552431 CCGCGCCTGTGCAGGGTCCCGGG + Intergenic
903883795 1:26529862-26529884 CCCCGGCTGCGCCGCCTCCCGGG - Intronic
904762635 1:32817072-32817094 CTGCGCCAGCGCCGAGTCCCCGG + Intronic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
911498797 1:98661597-98661619 CCGCGTCTGCGCAGCGGGCGAGG + Intergenic
912679756 1:111721566-111721588 CCACGGCTGCGCACAGTCCCCGG - Intronic
912915739 1:113812517-113812539 CCGCGCCCCCGCCGCGTCCCCGG + Intergenic
913209360 1:116570496-116570518 CCGCGCCCGCTCCCCGTCCCGGG + Intronic
917537976 1:175888181-175888203 CGGTGCCTGCACAGCCTCCCCGG - Intergenic
918283009 1:183023736-183023758 CCGCGCCGGCCCTGCGGCCCCGG + Exonic
922784301 1:228275563-228275585 CCGCAGCTGCGCACCCTCCCGGG - Intronic
923506416 1:234609668-234609690 CGGCGCCCGCGCAGCGCCCCCGG + Intergenic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1064086523 10:12349743-12349765 CTGCGCCCGCGCCGCGCCCCCGG + Exonic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1073196196 10:101694326-101694348 CCGAGCCGGCCCCGCGTCCCGGG - Intronic
1073452809 10:103619617-103619639 CCCAGCCTTCGCAGCCTCCCGGG + Intronic
1076608948 10:131708384-131708406 CCTCGCCTGTGCAGCCTGCCAGG + Intergenic
1077103856 11:833488-833510 CCGCGCCTGCCAAGCGTCCCCGG - Intronic
1083262018 11:61528302-61528324 CTGAGCCTGAGCAGCGTCCGTGG - Intronic
1083735061 11:64675473-64675495 CCTGGCCTGCCCAGCCTCCCAGG - Intronic
1084257929 11:67955418-67955440 CCGCCCCTACCCCGCGTCCCCGG + Intergenic
1084418543 11:69048922-69048944 CCGCGCCTGCGCAGTGAAGCTGG + Exonic
1089273211 11:117315692-117315714 CTGCCCCTGCGCAGCGGCCTGGG - Exonic
1090806877 11:130208456-130208478 CAGAGCCAGCGCAGCGCCCCTGG + Exonic
1094828997 12:34291298-34291320 CAGCCCCTGCACAGGGTCCCAGG - Intergenic
1094834848 12:34317504-34317526 CAGCCCCTGTGCAGAGTCCCGGG - Intergenic
1094836902 12:34326322-34326344 CAGCACCTGCGCAGGGCCCCAGG - Intergenic
1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG + Intergenic
1094839427 12:34336751-34336773 CCGCGCATGCGTGGGGTCCCGGG + Intergenic
1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG + Intergenic
1094840653 12:34341412-34341434 CCACGCATGCGCGGGGTCCCAGG + Intergenic
1094841113 12:34343088-34343110 CCGCACATGCGCGGTGTCCCAGG + Intergenic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094841970 12:34346000-34346022 CCGCGCATGCGCGGGGTCCCGGG - Intergenic
1094842170 12:34346725-34346747 CCACGCATGCGCGGGGTCCCTGG - Intergenic
1094842733 12:34348797-34348819 CCGTGCATGCGCGGGGTCCCGGG - Intergenic
1094842835 12:34349174-34349196 CCGCACATGCGCGGTGTCCCAGG - Intergenic
1094843195 12:34350467-34350489 CCGCACATGCGCGGTGTCCCGGG - Intergenic
1094843656 12:34352180-34352202 CCGCGCATGTGCGGGGTCCCAGG - Intergenic
1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG + Intergenic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1095937924 12:47705523-47705545 CCGCCCCATCGCAGGGTCCCTGG - Intronic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1102457172 12:113077964-113077986 CCGAGCCCGCGCCGCCTCCCGGG + Exonic
1102884101 12:116508676-116508698 GCGCGCCTGAGCAGCGGCCCTGG - Intergenic
1103989723 12:124790796-124790818 ACGTGCCTGCACAGCGGCCCAGG - Intronic
1104624317 12:130339089-130339111 CCGCCGCTGCGCTGCGCCCCCGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1108313934 13:49220308-49220330 CCGCGCGGCCGCCGCGTCCCGGG - Intergenic
1112580630 13:100674368-100674390 CGGCGCCTGCGGCGCGTCCCCGG - Intronic
1112752619 13:102597406-102597428 CCTCGCCCGCCCAGCGACCCTGG - Intronic
1113311689 13:109139476-109139498 CCGCACCTCCGCAGCCTCCATGG + Intronic
1113513724 13:110874805-110874827 CCGCGCCGGCGCCCCGCCCCCGG + Intergenic
1113861570 13:113490699-113490721 CCGCGCCTGCGCAGAAGGCCGGG - Exonic
1114484655 14:23055637-23055659 CCGGGCCTGGGCAGGGTCCCGGG - Exonic
1122232523 14:100313834-100313856 CCAGGCCCCCGCAGCGTCCCAGG - Intergenic
1122800960 14:104229261-104229283 CCCCTCCTGGGCAGGGTCCCCGG - Intergenic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1122978662 14:105181435-105181457 ACGTGCCTGCGCGGCTTCCCTGG - Intergenic
1124725122 15:32149366-32149388 CAGCACCGGCGCAGCTTCCCCGG - Intronic
1124966174 15:34434891-34434913 CTGGGCCTGGGCAGCGGCCCTGG - Intronic
1128161099 15:65423118-65423140 GCGCGCGGGCGCAGGGTCCCCGG - Intergenic
1128992504 15:72272547-72272569 CCGCCCCCGCGGGGCGTCCCGGG - Exonic
1132326373 15:100973600-100973622 CGGTGCCTTCGCAGCGGCCCCGG + Intronic
1132853281 16:2034301-2034323 CCACGCCTTCCCTGCGTCCCAGG + Intronic
1132853462 16:2034812-2034834 CCACGCCTTCCCTGCGTCCCAGG + Intronic
1133242824 16:4425853-4425875 CGGCGCAGGCGCAGAGTCCCCGG + Exonic
1136861550 16:33707235-33707257 CCGCGCCTGCGCCGCCGCCGTGG + Intergenic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1137531410 16:49281100-49281122 CCGCGCCTCCGCAGAGCCCTTGG + Intronic
1139510273 16:67424160-67424182 CCGCCCCTGCACAGGCTCCCTGG + Intergenic
1139952205 16:70677944-70677966 GCCCGCCTGCCCAGCGCCCCTGG + Intronic
1142518881 17:491454-491476 CCGCGCCTGCGGAGCCCCCGAGG - Intergenic
1146955862 17:36936118-36936140 CCGCGCCGGCGCCGCGCCTCCGG + Intergenic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1150433576 17:65137642-65137664 CCGCATCTGCGAAGCGTCCGAGG + Intronic
1151218115 17:72591756-72591778 CTGCGCCCCAGCAGCGTCCCCGG + Intergenic
1151419721 17:73989222-73989244 CCTCACCTGTGCAGCCTCCCAGG + Intergenic
1151831796 17:76557195-76557217 CCGCGGCTGCCCAGGGGCCCGGG - Intergenic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1158976763 18:62716625-62716647 CCGCGCCAGCCCAGCGCCCTCGG + Exonic
1160053134 18:75455558-75455580 CCAGGCCTGCGCGGCTTCCCAGG - Intergenic
1160701132 19:507924-507946 CAGCGCCGGCGCAGGGGCCCGGG + Intronic
1160937808 19:1605452-1605474 CCGCGCCTGCGCAGTGTAGCCGG - Exonic
1161425036 19:4198540-4198562 CCGCTCCTGCGCCCCCTCCCCGG - Intronic
1161764573 19:6199633-6199655 CTGCGCCAGCGCAGCGCTCCAGG + Intergenic
1161779157 19:6279734-6279756 CCGCCCCTGCGCAGCCCGCCCGG - Intronic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1165493545 19:36139539-36139561 CAGCGCCTGCGCCGCCTCCCAGG - Intergenic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
946285404 2:218698878-218698900 CGGCCCCTGCGCAGCCTCCTGGG + Exonic
948590924 2:239049750-239049772 CCGCCCCTCCCCAGCGTCCCAGG - Exonic
948786515 2:240355612-240355634 CCCCGCCAGCCCTGCGTCCCCGG + Intergenic
1171452840 20:25248027-25248049 CCGCGCCTGCGCGCCGCGCCGGG - Intergenic
1175394511 20:58649680-58649702 CCACCGCTGCGAAGCGTCCCCGG + Intergenic
1175514362 20:59559546-59559568 CCGCTCCTGCGCAGAGCCCTGGG + Intergenic
1175911445 20:62407158-62407180 CCGCGCCTCCGCAGCGCCTGCGG + Exonic
1176121924 20:63457920-63457942 CAGCGCCTGCTCACGGTCCCTGG + Intronic
1176180376 20:63746964-63746986 CCGCGGCCGCGCAGCCCCCCAGG - Exonic
1176306910 21:5128439-5128461 CTGCGCCTGCGCAGCCTTCGGGG + Exonic
1176414912 21:6468469-6468491 CTGCGCCTCCGCAGCGTCCCCGG + Intergenic
1179690412 21:43076791-43076813 CTGCGCCTCCGCAGCGTCCCCGG + Intronic
1179850149 21:44133591-44133613 CTGCGCCTGCGCAGCCTTCTGGG - Exonic
1179893663 21:44350167-44350189 CCGAGCGTGCGCCGCGTGCCCGG - Intronic
1180699716 22:17774558-17774580 CCGCGCCGGCGCGGGCTCCCCGG - Intronic
1181270819 22:21657619-21657641 CCGCACCTGCGCCGCGGCCGTGG + Intronic
1181312532 22:21952893-21952915 CTGCGCCTGCGCGGCGCCCGCGG - Intergenic
1183258186 22:36776519-36776541 CGGCGCCTGCGCAGTGGGCCAGG + Intergenic
1183546210 22:38455816-38455838 CCCCGCCTTGGCCGCGTCCCCGG + Intergenic
1184035047 22:41914274-41914296 CCGCGACACCGCAGCGCCCCGGG - Exonic
1184276579 22:43412249-43412271 GCGCCCCTGCGCAGCGCCGCGGG - Intronic
1184362107 22:44024723-44024745 CCGCGCCTGCTCTGCCTGCCGGG + Intronic
1184523134 22:45007530-45007552 CCCCGCCCGCGCCGCGCCCCCGG - Intronic
953027464 3:39153317-39153339 CCGCGCCCGCTCAGGGTGCCGGG + Intronic
954812305 3:53255795-53255817 CCCCGCCCGAGCCGCGTCCCCGG + Intronic
960097098 3:113699171-113699193 CCCCGCCTGCCCCGCGTCCCCGG + Intergenic
961502828 3:127349985-127350007 CCCCGCCTGCGCAGCAGCCTCGG - Intergenic
961775198 3:129279219-129279241 CCGCTAGTCCGCAGCGTCCCCGG - Intronic
961873165 3:130002734-130002756 CCGCCCCTACCCCGCGTCCCCGG + Intergenic
962247207 3:133805785-133805807 CCGCGCCTGCGCAGAGTGCAGGG + Exonic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
966866509 3:184261455-184261477 CGCCGCCTGCCCAGCGGCCCGGG - Exonic
968372873 4:11579-11601 CCGCGCCTGCGCCTTGTCCTCGG - Intergenic
968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG + Exonic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968524506 4:1049175-1049197 CAGCTCCTGCCCAGGGTCCCGGG + Intergenic
968801286 4:2744718-2744740 CCGCTCCAACGCAGCATCCCGGG + Exonic
968945713 4:3662612-3662634 CAGCCCCTGCACTGCGTCCCGGG + Intergenic
968950196 4:3687494-3687516 CCGCACCTGCCCAGCATCCATGG - Intergenic
969716860 4:8871950-8871972 CGGGGCCGGCGCAGCGTCCTCGG - Intergenic
973954499 4:56049382-56049404 CCGGGCCCCCGCAGCGCCCCGGG + Intergenic
985462523 4:190120988-190121010 CCGCGCCTGCGCCTTGTCCTCGG + Intergenic
985791602 5:1931164-1931186 CAGGGGCTGCGCCGCGTCCCCGG + Intergenic
988483273 5:31647120-31647142 CCTCACCTGCTCAGCTTCCCAGG + Intronic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
997704058 5:135930445-135930467 CCGCGCGTGCTCAGCGTTCGCGG - Intronic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1002455755 5:179344824-179344846 CGGCTCCTCCGGAGCGTCCCCGG + Intronic
1003157305 6:3607679-3607701 CCACGCCTGGGCTGCCTCCCAGG - Intergenic
1004864273 6:19837856-19837878 CCGCGGCTGCGGAGCCACCCAGG - Exonic
1007550781 6:42728032-42728054 CCGCGTCTGCGGAGAGGCCCTGG + Intergenic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1007781588 6:44257574-44257596 CCGCGACCACGCAGCGCCCCGGG + Intronic
1013306109 6:108848454-108848476 CCGCGCCAGCGCTGCATCCCTGG + Exonic
1014798283 6:125749533-125749555 CCGCCCCCGCGCACCGGCCCAGG - Intronic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1017671860 6:156777253-156777275 CCGCCCCGGCGCAGCCTCGCGGG - Intergenic
1019057121 6:169231899-169231921 CCCCGTCCGCGTAGCGTCCCCGG + Intronic
1019476550 7:1247322-1247344 CCGCGCCTCTGCAGCGGCCTTGG + Intergenic
1020257031 7:6508177-6508199 CAGCGCCTGAGCAGGGCCCCGGG + Exonic
1025032831 7:55571879-55571901 CCGCGCCTGCGCCGCGCCCGAGG + Intronic
1035287592 7:157816239-157816261 CCGTGCCTGCCCCGCCTCCCTGG + Intronic
1035751709 8:2001435-2001457 CAGCGCGGGCGCCGCGTCCCCGG + Exonic
1036739501 8:11347851-11347873 CCGGGCGCGCGCAGGGTCCCCGG + Intergenic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1038542598 8:28402182-28402204 CGGGGCCTGCGCAGCGTCGGTGG + Intronic
1040079386 8:43271984-43272006 TTGCGCCTGCGCAGCGTCCCGGG - Intergenic
1042155735 8:65842144-65842166 CCGCGCCGCCGCAGCGCCCAGGG + Intronic
1046003022 8:108443925-108443947 CCGCGCCAGTCCAGCGTCCCGGG + Intronic
1049182650 8:141230949-141230971 CGCCGCCAGCACAGCGTCCCCGG - Intronic
1049625422 8:143617599-143617621 CCGGGGGCGCGCAGCGTCCCGGG + Intronic
1051641801 9:19230672-19230694 CTGCGCCTGCGCCGCCTCGCGGG - Exonic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1053643676 9:40109347-40109369 CAGCGCTTGCGCTGCGCCCCAGG + Intergenic
1053762477 9:41356143-41356165 CAGCGCTTGCGCTGCGCCCCAGG - Intergenic
1054324531 9:63706578-63706600 CAGCGCTTGCGCTGCGCCCCAGG + Intergenic
1054541074 9:66267260-66267282 CAGCGCTTGCGCTGCGCCCCAGG - Intergenic
1056256161 9:84801504-84801526 CTGCCCCTGCTCAGCGTCACAGG - Intronic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060192004 9:121599433-121599455 CCCCGCCCGCGCTGGGTCCCGGG + Intronic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1061321726 9:129835251-129835273 GCGCCTCTGCGCAGCGGCCCAGG + Exonic
1062613406 9:137385294-137385316 CCCCACCTGGGCATCGTCCCGGG - Intronic
1186466300 X:9786522-9786544 GCGCGACCGCTCAGCGTCCCTGG - Exonic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1191184261 X:57592644-57592666 CCGCTCCTGCCCAGCAGCCCGGG + Exonic
1191213133 X:57909815-57909837 CCGCTCCTGCCCAGCAGCCCAGG - Exonic