ID: 1154213139

View in Genome Browser
Species Human (GRCh38)
Location 18:12396876-12396898
Sequence CTGTTGGAGTGGTGGGCGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154213134_1154213139 13 Left 1154213134 18:12396840-12396862 CCACTTACTATTTACTTAAAAAC No data
Right 1154213139 18:12396876-12396898 CTGTTGGAGTGGTGGGCGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154213139 Original CRISPR CTGTTGGAGTGGTGGGCGAT TGG Intergenic
No off target data available for this crispr