ID: 1154218579

View in Genome Browser
Species Human (GRCh38)
Location 18:12433204-12433226
Sequence GCTGCTCGTGCGCAGGGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154218564_1154218579 18 Left 1154218564 18:12433163-12433185 CCCATCGAAGCCCACAGGCCGTG No data
Right 1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG No data
1154218565_1154218579 17 Left 1154218565 18:12433164-12433186 CCATCGAAGCCCACAGGCCGTGG No data
Right 1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG No data
1154218562_1154218579 27 Left 1154218562 18:12433154-12433176 CCTACTGCTCCCATCGAAGCCCA No data
Right 1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG No data
1154218572_1154218579 -6 Left 1154218572 18:12433187-12433209 CCCTGAGGGCACCCAGTGCTGCT No data
Right 1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG No data
1154218568_1154218579 8 Left 1154218568 18:12433173-12433195 CCCACAGGCCGTGGCCCTGAGGG No data
Right 1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG No data
1154218571_1154218579 0 Left 1154218571 18:12433181-12433203 CCGTGGCCCTGAGGGCACCCAGT No data
Right 1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG No data
1154218570_1154218579 7 Left 1154218570 18:12433174-12433196 CCACAGGCCGTGGCCCTGAGGGC No data
Right 1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG No data
1154218573_1154218579 -7 Left 1154218573 18:12433188-12433210 CCTGAGGGCACCCAGTGCTGCTC No data
Right 1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154218579 Original CRISPR GCTGCTCGTGCGCAGGGTCC GGG Intergenic
No off target data available for this crispr