ID: 1154221545

View in Genome Browser
Species Human (GRCh38)
Location 18:12459295-12459317
Sequence AGCCCATGCCCTGGTTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154221545 Original CRISPR AGCCCATGCCCTGGTTGTGC AGG Intronic
900601383 1:3504183-3504205 AGCCCAGGCCATGGTCATGCTGG + Intronic
900624829 1:3603351-3603373 AGCCCCTGCTCTGGGGGTGCTGG - Intronic
901036503 1:6339121-6339143 AGCCCCTGCCATGGATGAGCTGG + Intronic
902294429 1:15456822-15456844 TTCCCATGCCCTGGTGGGGCTGG + Intronic
903076889 1:20777238-20777260 ACCCCAGGCACTGGTTATGCAGG + Intronic
903744469 1:25577357-25577379 AGCCCAGGTCCTGGTGGTCCTGG - Intergenic
904338437 1:29812957-29812979 AGCCCAAGCCAGGGTGGTGCAGG + Intergenic
911430715 1:97783199-97783221 ACTCCATGCCCTAGTTGTACAGG + Intronic
911472839 1:98339614-98339636 ATCCAATGCCCTGATGGTGCAGG - Intergenic
917157904 1:172024830-172024852 ACCCCAGGCCCTGGTGGTGTAGG - Intronic
919465665 1:197919875-197919897 AGACCAAGCCCAGGGTGTGCAGG - Intronic
919813741 1:201424971-201424993 AGGCCAGGCCCTGGTGGGGCTGG - Intronic
919913582 1:202126785-202126807 AGCCCAGGACCTGGCTGTGTGGG - Intronic
920059753 1:203219245-203219267 AGCCCACCCACTGGTTGTCCCGG + Exonic
922657701 1:227400629-227400651 AGCCAAAGCCCTGGGTGTGGTGG - Intergenic
922793392 1:228323409-228323431 AGCCCATGCCCAGTGTGCGCTGG + Exonic
1066967183 10:42279904-42279926 AAGCCATGCCCTAGTCGTGCTGG - Intergenic
1067898524 10:50212853-50212875 AGCAAATGCTCAGGTTGTGCTGG - Intronic
1068554110 10:58439091-58439113 AGCCCATGCACTGGTTGGGAAGG + Intergenic
1069604354 10:69730383-69730405 AGCCCTGGCCCTGGTCCTGCTGG - Intergenic
1069797647 10:71063544-71063566 GCCCCAAGCCCTGGCTGTGCTGG - Intergenic
1070336090 10:75456188-75456210 AGCCCATTCCCAGGCTGAGCAGG + Intronic
1070771109 10:79082811-79082833 AGCCCATGCACTGAATGGGCTGG + Intronic
1070808832 10:79287044-79287066 GGCCCATGTCCTAGGTGTGCTGG - Intronic
1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG + Intergenic
1070846495 10:79526632-79526654 AGCCTCTGCCCTCGTTCTGCAGG - Intergenic
1070927298 10:80233642-80233664 AGCCTCTGCCCTTGTTCTGCAGG + Intergenic
1079103279 11:17554669-17554691 GGGCCATGCCCTGGATGGGCGGG + Intronic
1083755426 11:64789424-64789446 AGCCCAGGCCCTGGCCCTGCTGG - Exonic
1084166827 11:67379035-67379057 AGCCCTTGCTCTTGTTCTGCTGG - Intronic
1085386526 11:76161215-76161237 TGCCCCTGCCCTGGGTCTGCCGG + Intergenic
1088740729 11:112764927-112764949 ACCCCATCCCCTGGATGTGCAGG + Intergenic
1089346528 11:117795165-117795187 AGCCCATTCCCGGGGAGTGCAGG - Intronic
1089491447 11:118886676-118886698 AGCCCAGGCCCTGGTTCTGTTGG - Intronic
1090669118 11:128933854-128933876 AGCACATGGCCTTGATGTGCAGG - Intergenic
1091252875 11:134158397-134158419 AGCACTTGCCCTGGGTGTGCAGG + Exonic
1091565641 12:1646036-1646058 AGCCCGTGCTCTCGTTGCGCAGG - Exonic
1092536388 12:9391892-9391914 TGCCCATGCCCTGGTTTTGATGG - Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094267221 12:28572904-28572926 AGCCCATGTCCGGGGTGGGCAGG + Intronic
1097108085 12:56636816-56636838 AGCCCCTGAGCTGCTTGTGCTGG - Intronic
1099434363 12:82625908-82625930 AGCCCAAGCCCAGATTCTGCTGG + Intergenic
1100156274 12:91804148-91804170 ACCCAATGCCCTGGTGGTGTGGG - Intergenic
1106680441 13:32001688-32001710 CTCCCATGGCCTGGTTGTTCTGG + Intergenic
1107262758 13:38514807-38514829 AGCACCTGACCTGGTTGTGCAGG + Intergenic
1110720721 13:78758625-78758647 GGCCCATGCCCTGGTTTTTCAGG - Intergenic
1113839150 13:113348745-113348767 AGGCCTTGCCCTGGTTCTGCTGG - Intronic
1115851258 14:37592060-37592082 AGCCCTTGCCCGGCTTGTCCGGG + Exonic
1118457759 14:65960182-65960204 AGACCACCCCCTGGCTGTGCTGG - Intronic
1118601459 14:67473543-67473565 ACGCCGTGCCCTGGTTCTGCGGG - Exonic
1119248320 14:73131701-73131723 AAGCCATGCCCTGTCTGTGCGGG - Intergenic
1119406758 14:74403812-74403834 GGTCCATGCCCTGCTTGGGCTGG - Intergenic
1122192494 14:100057156-100057178 AGCACATGCCCTGGTGGTTCAGG - Intronic
1122891764 14:104735287-104735309 AGCCCAGGCCCGGGCTATGCAGG - Intronic
1123403439 15:20006749-20006771 AGCCCCTGCACAGGTGGTGCTGG + Intergenic
1123512777 15:21013403-21013425 AGCCCCTGCACAGGTGGTGCTGG + Intergenic
1124602957 15:31150010-31150032 AGCCCATCCTCTAGCTGTGCAGG + Intronic
1127034793 15:54904018-54904040 AGCACATGCGCAGGATGTGCAGG + Intergenic
1128335861 15:66785477-66785499 TCCCCATGCCCTGGTTGTGATGG + Intergenic
1128552925 15:68609780-68609802 AGCCCATGCCCTGGGACTGGAGG + Intronic
1129256079 15:74334893-74334915 GGCTCAGGCCCTGGTTGTCCTGG + Intronic
1130577528 15:85105715-85105737 AGCCCAAGCCCTGGCTATGGAGG + Intronic
1132123262 15:99196649-99196671 AGCCCATACTCAGGTGGTGCTGG - Intronic
1132306884 15:100821697-100821719 TGCCCATGGCCTGGGTGGGCAGG - Intergenic
1132482843 16:175209-175231 AGGCCCTGCCCTGGGTGTCCAGG - Intergenic
1132650359 16:1018813-1018835 AGCCCAGGCCCTTGGTGAGCTGG + Intergenic
1132650369 16:1018864-1018886 AGCCCAGGCCCTTGGTGAGCTGG + Intergenic
1132827863 16:1913962-1913984 TGCCCAGGGCCTGGTTCTGCGGG - Intronic
1136733252 16:32439244-32439266 AAGCCATGCCCTAGTCGTGCTGG - Intergenic
1137858410 16:51820082-51820104 AACCCATGCCATGGTGGTCCAGG - Intergenic
1139140738 16:64259441-64259463 ATCCCATGCCCTGTTTGGGATGG - Intergenic
1141087843 16:81109386-81109408 AGCCACTGCCCTGGCTGGGCTGG + Intergenic
1141751357 16:85960605-85960627 AGCCGTTGCTCTGGTTGTGAAGG - Intergenic
1142017106 16:87755413-87755435 AGCCCATGGCCTCCCTGTGCTGG - Intronic
1142224499 16:88870993-88871015 AGCCCATGCCCTGGGTCTGCAGG - Intergenic
1203019831 16_KI270728v1_random:390358-390380 AAGCCATGCCCTAGTCGTGCTGG + Intergenic
1203038166 16_KI270728v1_random:663516-663538 AAGCCATGCCCTAGTCGTGCTGG + Intergenic
1143513877 17:7409722-7409744 AGCACATGCCGTGGAGGTGCTGG - Intronic
1143875027 17:9985037-9985059 AGCCCTGTCCCTGGTTGTCCAGG - Intronic
1144450190 17:15370633-15370655 ACCCCAACCCCTGGTTGTGGGGG - Intergenic
1148740415 17:49889715-49889737 AGGCCCTGACCTGGTTGGGCAGG + Intergenic
1151670290 17:75568486-75568508 CCCCTATGCCCTGGTGGTGCTGG + Exonic
1151683146 17:75632322-75632344 AGCGCATGGCCTGGGTGTGTAGG + Intronic
1154221545 18:12459295-12459317 AGCCCATGCCCTGGTTGTGCAGG + Intronic
1155399107 18:25418633-25418655 AGCCCATCCACTGGCTTTGCTGG + Intergenic
1157063664 18:44321960-44321982 TGCACATGCCCTGGTTGTTGGGG + Intergenic
1158895794 18:61911710-61911732 AGCCCCTGCACTAGCTGTGCAGG - Intergenic
1160026678 18:75223731-75223753 AGCCCTGGCCCTGCATGTGCTGG + Intronic
1160585864 18:79913051-79913073 AGCCCATGTCCTGGCTGGACAGG + Intronic
1160837066 19:1129762-1129784 CGCCCAGGCCTTGGTGGTGCAGG + Intronic
1160865815 19:1255516-1255538 GGGGCATGCCCTGGTAGTGCCGG - Exonic
1161104101 19:2434718-2434740 GGGCCCTGCCCTGGATGTGCGGG - Intronic
1161984132 19:7644607-7644629 AGCCCATGGCCAGGTCCTGCGGG - Exonic
1162295574 19:9811132-9811154 TGCCCCTGGCCTGGCTGTGCTGG - Exonic
1162895237 19:13761494-13761516 AACCCTTGCCCTGGTGGAGCTGG - Intronic
1163845266 19:19635024-19635046 ACACCGTGCCCTGGATGTGCAGG - Exonic
1164728533 19:30483509-30483531 GGACCATGCCCTGGGTGTTCTGG - Intronic
1165104718 19:33462125-33462147 AGCCCCGGCCCTGGGGGTGCTGG - Intronic
1166336957 19:42114107-42114129 AGCCCAGGCCCTGATTGTCAAGG - Intronic
1167334885 19:48878775-48878797 GGCCCACGCCCTGGTTTTTCAGG + Intergenic
925320377 2:2961812-2961834 AGCCCATGCTCTGGTGATCCTGG + Intergenic
925686113 2:6475696-6475718 CTCCCACGCCCTGGTGGTGCAGG - Intergenic
929569656 2:43013992-43014014 AGCCCATTTCCTGCTGGTGCAGG - Intergenic
931616775 2:64167363-64167385 AGAACATGCCATGGTTCTGCAGG + Intergenic
931802965 2:65776804-65776826 ACACCATGCCGTGGTTCTGCTGG - Intergenic
934566584 2:95344903-95344925 AGCCTGTGCCCAGGTAGTGCCGG - Intronic
934924122 2:98369861-98369883 AGCCCTTGCCCTTGATGAGCTGG + Intronic
936818065 2:116484648-116484670 TGCCCAGGCCCTGGTTATGGAGG - Intergenic
937008075 2:118536105-118536127 AACCCATGCCCAGGATGAGCTGG + Intergenic
937237734 2:120440982-120441004 AGGCCATGGCCTGCCTGTGCTGG + Intergenic
938230174 2:129651608-129651630 AGTCATTGCCCAGGTTGTGCAGG - Intergenic
941276543 2:163497711-163497733 AACCCAGGCCCTGGTGGTGTAGG - Intergenic
942534879 2:176952387-176952409 AGAACATTCCCTGATTGTGCTGG + Intergenic
946193527 2:218020275-218020297 AGCCCCTCCCCTGGATCTGCAGG + Intergenic
946202069 2:218076311-218076333 AGGCCATGCCCTGGCAGGGCTGG - Intronic
946660829 2:221997671-221997693 AGACCATGCTCTGGGTGTCCAGG + Intergenic
947702453 2:232245787-232245809 AGCACATGCAGTGGTTGTGCAGG - Intronic
1173352918 20:42261506-42261528 AGCCCATCCCCAGGCTGTGTGGG - Intronic
1179489179 21:41729124-41729146 AGCTCATGTCCTGGCTGTACAGG + Intergenic
1180539214 22:16425841-16425863 AAGCCATGCCCTAGTCGTGCTGG + Intergenic
1180604546 22:17047302-17047324 AGCCTCTGCCCTCGTTCTGCAGG + Intergenic
1180944983 22:19687900-19687922 AGCCCTTGCCCCAGTTGTGCAGG - Intergenic
1181040701 22:20191329-20191351 AGCCCAGGAGCTGGCTGTGCAGG + Intergenic
1181665118 22:24389839-24389861 ATCTCATGCCTGGGTTGTGCAGG - Intronic
1183628247 22:39017874-39017896 AGCCCTTGCCCAGACTGTGCAGG + Exonic
1183630849 22:39031802-39031824 AGCCCTTGCCCAGAGTGTGCAGG + Exonic
1183634365 22:39052182-39052204 AGCCCTTGCCCAGAGTGTGCAGG + Exonic
1183637048 22:39070501-39070523 AGCCCTTGCCCAGAGTGTGCAGG + Intronic
1183639379 22:39083848-39083870 AGCCCCTGCGCTGGTTCAGCAGG - Exonic
1184798287 22:46744671-46744693 GGCCTCTGCCCTGGCTGTGCTGG - Intergenic
949920070 3:8993486-8993508 AGCCCAAGCCCTGGGTGGGGAGG - Intronic
949985309 3:9536261-9536283 AGCCCCTGCCCTGGATGGGCAGG - Intronic
952616345 3:35278163-35278185 ACCCCAGGCCCTGGTGGTGTTGG - Intergenic
953392269 3:42540549-42540571 AGCCCATGCCCTGGAGTGGCAGG - Intergenic
954453996 3:50587146-50587168 AGCCCAGGACCTAGTTATGCTGG - Intergenic
956243358 3:67154302-67154324 ACCCAATGCCCTGGTGGTGTAGG - Intergenic
961547513 3:127645560-127645582 AGCCCATGGCCTGGTTGGCAGGG - Intronic
966881678 3:184354365-184354387 AGGACCTGCCCTGGTTGTGGAGG - Intronic
967822831 3:193854080-193854102 AGCCTATGCCCTTGTAGTTCAGG + Intergenic
968562942 4:1294638-1294660 AGCCCAGGGCCTGACTGTGCAGG - Intronic
968688481 4:1977115-1977137 AGCCCCTGTCCTGGATGTGCAGG + Intronic
973081898 4:46003361-46003383 AACCCAGGGCCTGGTGGTGCAGG + Intergenic
977809212 4:101339538-101339560 ACTCCATGCCCTGATTGGGCTGG + Intronic
977928614 4:102728812-102728834 AACCACTGCCCTGGTGGTGCTGG + Intronic
977944656 4:102898044-102898066 AAGCCATGCCCTAGTCGTGCTGG + Intronic
978355129 4:107863999-107864021 AGTCCATGTCCTGTTTGTGTTGG - Intronic
982288809 4:153759993-153760015 CGGCCCTGCCCGGGTTGTGCGGG + Exonic
986110308 5:4709662-4709684 ACCCCAGGCCCTGGTGGTGTAGG - Intergenic
997643603 5:135465948-135465970 GGCCCTTGCCCCGGTTCTGCAGG + Intergenic
997693929 5:135846455-135846477 AAGCCATGCCCTGGCTGTCCTGG - Intronic
998570199 5:143250228-143250250 TGCCCTTGCCCTGGTTGGGGTGG - Intergenic
999331858 5:150678959-150678981 AGCCCATTCCCAGGGTGTGTGGG + Exonic
1000384126 5:160657638-160657660 AGCCCATGCCCTGTATGTTCAGG - Intronic
1001239288 5:170055989-170056011 ACCCCATGCCCAGGTTGTAATGG + Intronic
1001600708 5:172926437-172926459 AGGCCTGGCCCTGGTTGTGGGGG - Intronic
1001878090 5:175218160-175218182 AGCCCAGGGCCTGGGTTTGCTGG - Intergenic
1002260507 5:177990867-177990889 ACCCCTTGCCCTGCTTCTGCAGG + Intergenic
1008369296 6:50714782-50714804 AGCCCCTGCCCAACTTGTGCAGG - Intronic
1008707510 6:54181285-54181307 AGCCCATGTGCTGGTGGTGTTGG - Intronic
1010824869 6:80460547-80460569 AGCCCAAGCCCTTTTTGTTCAGG + Intergenic
1015385581 6:132619249-132619271 AGCCCATGCCCTCCTTGTGTTGG + Intronic
1017579550 6:155848412-155848434 ATTCTATGCCCTGGTTGTGATGG + Intergenic
1017922817 6:158886413-158886435 AAGCCATGCCCTGTCTGTGCGGG - Intronic
1019152653 6:170019152-170019174 AGCCCCTCCCCTGCCTGTGCTGG + Intergenic
1019217409 6:170452600-170452622 ACCCCTTGCCCTGGTCCTGCTGG - Intergenic
1019297347 7:285135-285157 GGCCTATGCCCTGGTTCTGAAGG - Intergenic
1019427663 7:985008-985030 GGCCCACGCCCAGGCTGTGCAGG - Exonic
1019604446 7:1901521-1901543 AGCCCATGCACTGCTGTTGCAGG - Intronic
1021098518 7:16561449-16561471 AGCCCATGCCCTGCTTGTCAAGG + Intronic
1021841088 7:24722511-24722533 AGCCCATGCCTTAGTTGTGAGGG - Intronic
1022891062 7:34700042-34700064 AACCCATGGCCAGGTTTTGCTGG + Intronic
1024666091 7:51548640-51548662 AGCCCCTGCCCTGCTTGTACAGG + Intergenic
1025725484 7:64054149-64054171 AAGCCATGCCCTGGATGTGAGGG + Intronic
1025790122 7:64681013-64681035 AAGCCATGCCCTGTTTGTGCAGG + Intronic
1027266353 7:76497085-76497107 AGCCCGTGCCCTCAGTGTGCAGG - Intronic
1027317733 7:76995203-76995225 AGCCCGTGCCCTCAGTGTGCAGG - Intergenic
1029633423 7:101767835-101767857 TGTCCATCCCCTGGCTGTGCAGG + Intergenic
1032240513 7:130155278-130155300 TGCCCAGGCCCTGCTGGTGCTGG - Intergenic
1034056665 7:148042480-148042502 AGACCCAGCCCTGGTTCTGCAGG + Intronic
1035245117 7:157558217-157558239 TGCCCTGGCACTGGTTGTGCAGG - Intronic
1035283555 7:157792537-157792559 AGCAGATGCCCTGGACGTGCAGG - Intronic
1035760626 8:2066133-2066155 AGCCCGTGCCCTGGTCCAGCCGG + Intronic
1039079717 8:33722730-33722752 GGCCCAGGTCCTGGTGGTGCTGG + Intergenic
1039886828 8:41659588-41659610 AGCCTTTGCCCTGGTTGGGAGGG + Intronic
1047955564 8:129972793-129972815 ACTCTATGCCCTGGGTGTGCTGG - Intronic
1049215469 8:141405871-141405893 AGCCCTTGCACTGCCTGTGCTGG - Intronic
1049273065 8:141706396-141706418 AGCTGATGCCCTGGGTGTGTGGG + Intergenic
1049587929 8:143440566-143440588 AGCCAAGGCCCTGGATGTGAGGG - Intronic
1049602866 8:143515982-143516004 AGCCCAGGCCCTGCAGGTGCAGG + Intronic
1049709357 8:144056703-144056725 AGTCCGTGCCCTGGTAGCGCAGG + Exonic
1053104782 9:35400160-35400182 AGCCTATGCTCTGGTTCTGTGGG + Intronic
1056324902 9:85469121-85469143 AGCCCATGGCGTAATTGTGCTGG - Intergenic
1056543225 9:87592263-87592285 AGCCCATGCTGTGGTTGGGTGGG - Intronic
1056777897 9:89527168-89527190 AGCCCACACCTTGGTTGTGGAGG - Intergenic
1058546865 9:106069752-106069774 AACCCATCACCTGGTTCTGCTGG - Intergenic
1059251544 9:112891157-112891179 AGCCCCTGCCCCGGTGGTGGGGG - Intergenic
1061402338 9:130375399-130375421 AGCCCATGCCCGGGGTGGCCAGG - Intronic
1061934246 9:133848630-133848652 AGCACATGGCCTGGTTTTGAAGG - Intronic
1062579925 9:137224957-137224979 AGGCCATGCCCCGGATGTGAGGG + Exonic
1062585994 9:137250355-137250377 GGCCCCTGCCCAGGTTGTGCCGG - Intergenic
1186496714 X:10016432-10016454 TGCCCCGGCCCTGGTTCTGCAGG + Intronic
1188891112 X:35611782-35611804 AAGCCATGCCCTGTCTGTGCAGG + Intergenic
1193073707 X:77333208-77333230 AGCCAAGGCCCTGGTGGTGTGGG + Intergenic
1194035861 X:88871187-88871209 AGCCCATCCACTAGTTGAGCAGG + Intergenic
1195542315 X:106076513-106076535 AGCCCAGGCTCTGGTTGAACAGG - Intergenic
1200117072 X:153774077-153774099 AGGCCATGTCCTGGATGTGGAGG + Exonic
1200117136 X:153774348-153774370 AGTCCGTGCCCTGGGTGGGCAGG + Intronic
1200234419 X:154461416-154461438 GGCCCAGGCCCTGGGCGTGCCGG + Exonic