ID: 1154226005

View in Genome Browser
Species Human (GRCh38)
Location 18:12504894-12504916
Sequence CAAGGCAAAGGCTCTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154226001_1154226005 -5 Left 1154226001 18:12504876-12504898 CCTGAGAGAAGGAATATCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 204
Right 1154226005 18:12504894-12504916 CAAGGCAAAGGCTCTGTTACAGG 0: 1
1: 0
2: 0
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154226005 Original CRISPR CAAGGCAAAGGCTCTGTTAC AGG Intronic
903353222 1:22730673-22730695 CTGGGCAAAGGCCCTGTGACAGG + Intronic
908826812 1:68141191-68141213 CCAGACACAGGCTCTCTTACCGG + Intronic
909504169 1:76369152-76369174 CAAGACTAATGCTTTGTTACTGG + Intronic
911740686 1:101384078-101384100 CAAGACAAAGTCTATGTTAACGG - Intergenic
916249700 1:162724974-162724996 CCAGAGAAAGGCTCTTTTACTGG - Intronic
917067758 1:171115254-171115276 CACGGCACAGGCTCTCTTAAGGG + Intronic
921067482 1:211633003-211633025 GAAACCACAGGCTCTGTTACAGG + Intergenic
921329430 1:214020876-214020898 CAAGACAAAGACTCTGTTAAGGG + Intronic
921522406 1:216172918-216172940 AAAGGCAAGGTCTCTGCTACAGG - Intronic
1064219170 10:13425018-13425040 CCAGGCAAAGGCCCTGTTCCTGG - Intergenic
1065156331 10:22873750-22873772 CCATGCAAAGGCTCTGAGACAGG - Intergenic
1071051702 10:81458519-81458541 CAAGGCAGAGCTTCTGTTCCAGG + Intergenic
1074047540 10:109852307-109852329 CAAAGCACAGGCTCTGTGAGGGG + Intergenic
1076447497 10:130526682-130526704 GAAGGCAAGGGCTCTGCCACAGG - Intergenic
1076877920 10:133225650-133225672 CAAGACAGAGGCTCTGTGGCGGG + Exonic
1080134263 11:28835984-28836006 CAAGGTCAAGGCCCTGTTAGAGG - Intergenic
1080233281 11:30042041-30042063 CAAGGCCCAGCCACTGTTACAGG + Intergenic
1090009614 11:123034634-123034656 CACGGCAAAGGCAGTGTTCCAGG - Intergenic
1090135030 11:124188635-124188657 CATCTCAAAGGCTCTGTTATTGG + Intergenic
1090201042 11:124856584-124856606 CAACGCAAAGGCCCTGAGACAGG - Intergenic
1092073812 12:5656420-5656442 CAAGGGAATGCCTCTGTTTCAGG - Intronic
1092085079 12:5750345-5750367 GAAGGCACAGCCTCTGTTTCAGG - Intronic
1092953546 12:13529362-13529384 CAGTGCAAAGGCTCTGTGAAAGG - Intergenic
1093797655 12:23332541-23332563 CAAGGCAAAGGTGATTTTACAGG - Intergenic
1095240489 12:39853142-39853164 CTAGGCAATGGCTTTGTTACTGG - Intronic
1095939892 12:47719305-47719327 AAAGGCATAGGCTCTGATTCCGG + Intronic
1096081285 12:48834562-48834584 CAAGACAAAGTCACTCTTACGGG + Intronic
1098867879 12:75783350-75783372 CAAGGCAAAGTCTCTATTTCAGG + Intergenic
1099094642 12:78358573-78358595 CATGCCATCGGCTCTGTTACAGG - Intergenic
1101256650 12:102984424-102984446 AAACGCAAAGGCTCTGAGACAGG + Intergenic
1107149880 13:37098808-37098830 AAGGGCAAAGGCTCTGAAACAGG - Intergenic
1109328477 13:60899446-60899468 CAAGCCAAAGCTTCTGTTAGAGG + Intergenic
1109369005 13:61397192-61397214 CAACTCCAAGCCTCTGTTACAGG + Intergenic
1110142101 13:72143314-72143336 CAAGGCAAAGGTTCTCATTCTGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112553254 13:100442884-100442906 CAAAGCAGAGGCTCTGAAACGGG + Intronic
1118110476 14:62712683-62712705 CATGGCAAACGCTCTGTGAAGGG - Intronic
1118385531 14:65252752-65252774 CAAGGAGAAGGCTCTGTAACAGG - Intergenic
1118889774 14:69899160-69899182 GATGGCAAAGGCCTTGTTACGGG + Intronic
1119634092 14:76259983-76260005 AAAAGCATAGGCTCTGTTATGGG + Intergenic
1120622791 14:86786351-86786373 CAAAGTAAAGGTTCTGTAACTGG - Intergenic
1121962947 14:98278017-98278039 CAAAACAAAGGCTGAGTTACTGG + Intergenic
1124214290 15:27793795-27793817 TAAGGAAAAGGCTCTGTCATTGG - Intronic
1125354725 15:38804969-38804991 CAATGCAAAGGCTCTGAGCCTGG + Intergenic
1125410466 15:39400657-39400679 CAAGGGAAAGTCTTTGTCACTGG + Intergenic
1128048854 15:64644578-64644600 CAAGGCAGAAGCTCTGGTAAAGG - Intronic
1128403569 15:67311937-67311959 CAGTGCAAAGGCTCTCTTCCTGG - Intronic
1128745987 15:70114462-70114484 ACAGGCAAAGGCTCTGTTTTAGG - Intergenic
1129026687 15:72582280-72582302 CATGGCAAAAGCTCAGTTGCTGG - Intronic
1129715597 15:77847459-77847481 CAAAGCAAAGGCACTGCTAAGGG + Intergenic
1133171625 16:3985662-3985684 CAAGCCAAGGGCTCGGGTACAGG + Intronic
1134422219 16:14104500-14104522 GAAAGCTAAGGCTCTGCTACAGG - Intronic
1135167321 16:20150883-20150905 CAAGGGAAAGTCTCTGTAGCAGG - Intergenic
1138500390 16:57439057-57439079 CAAGGAAAAGGTTTTGCTACAGG + Intronic
1141030342 16:80582062-80582084 CAAGGCAAGTGCTCAGATACAGG + Intergenic
1144698695 17:17322784-17322806 CAAGGCCAAGCCTGTGTTTCAGG + Intronic
1146812069 17:35911722-35911744 CTAGGCAAAGGCATGGTTACAGG - Intergenic
1147615550 17:41825315-41825337 CAGGGCACAGGCACTGTTCCTGG - Intronic
1148629953 17:49099751-49099773 CTAGGCAAAGGCTTTGCCACTGG - Intergenic
1149261256 17:54882288-54882310 CCAGAAAAAGGCACTGTTACAGG + Intergenic
1149536165 17:57435276-57435298 CAGTGCAAAGGCCCTGTGACGGG + Intronic
1150617427 17:66783145-66783167 GAATGCACAGGCTCTGTCACGGG + Intronic
1154226005 18:12504894-12504916 CAAGGCAAAGGCTCTGTTACAGG + Intronic
1161408348 19:4102733-4102755 CACGGCAGAGGCTCTGCTCCGGG + Intronic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1161636631 19:5393377-5393399 CCAGGCAAAGGCCCTGGGACAGG - Intergenic
1161646107 19:5454472-5454494 CATGGGAAAGACTATGTTACAGG + Intergenic
1161772259 19:6237181-6237203 CAAGGCAAAGGCCCTGTGGCCGG + Intronic
1161792630 19:6369582-6369604 CAGTGCAAAGGCCCTGTGACAGG + Intergenic
1162044996 19:7993263-7993285 CAACCCAAAGGCTTTTTTACAGG - Intronic
1166780542 19:45340479-45340501 CAAGGAAAAGGCTCTGGGGCAGG + Intronic
925523933 2:4778999-4779021 CGAGGTAAAAGCTTTGTTACAGG - Intergenic
928716960 2:34072338-34072360 GAAAGAAAAGGCTCTGTGACAGG - Intergenic
929810926 2:45188674-45188696 CAAGGCAGAGGCAGTGTTCCTGG - Intergenic
931984446 2:67728006-67728028 TAAGGCTAAGGCTCTCTTAGTGG - Intergenic
932267279 2:70378611-70378633 GGAGGCAAAGGCTCTAATACTGG - Intergenic
933362221 2:81302720-81302742 AAAGGGAAAGGATCTGTTGCTGG - Intergenic
936953350 2:118000405-118000427 CAACGCAAAAGCACTGTGACAGG + Intronic
944282282 2:197911793-197911815 AAAGGCACAGGCTATGTTGCAGG - Intronic
944522480 2:200586281-200586303 GAAGGCAAAGCCGCTGTTACGGG - Intronic
947329889 2:229017196-229017218 CAAGGCACAGGCTCTGCTAGAGG + Intronic
947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG + Intronic
947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG + Intergenic
948058287 2:235025791-235025813 AAAGGCAAAGGCACTGTTTCAGG + Intronic
1168827342 20:822821-822843 CCAGGCACAGGCTCGGTTAGAGG + Intergenic
1170423928 20:16219356-16219378 CAAGGCAAACACTCTATAACTGG + Intergenic
1174624674 20:51904181-51904203 CAGGGCAAAGGCTCTGGTGCAGG + Intergenic
1183140772 22:35936658-35936680 CATGGCAAAGGGTCTGTAACAGG + Intronic
1184651282 22:45920491-45920513 CCAGGCAAAGGGCCTGTTGCTGG + Exonic
1184704530 22:46201512-46201534 CAAGGAAAAGGCTCCGTGTCAGG + Intronic
950705071 3:14774478-14774500 CAGGGCAGAGGCTTTGTTTCAGG - Intergenic
954802268 3:53194108-53194130 CATGGCATAGGCTCTGTTCTGGG + Intergenic
955103719 3:55876277-55876299 CAAGGCAAAGAAAATGTTACAGG + Intronic
963893666 3:150662897-150662919 AAATGCAAAGACTCTGTGACAGG + Intronic
967085804 3:186093938-186093960 CAAGGCAATGGACCTGTTGCGGG + Intronic
968511880 4:999414-999436 CAGTGCAAAGGCTCTGGAACAGG - Intronic
969443260 4:7229444-7229466 CAAGACAGAGGCTCTCTTTCTGG - Intronic
970349178 4:15183965-15183987 CAAGGCAAAGGCTCCTGTAATGG + Intergenic
971346692 4:25818118-25818140 CGAGGCAAAGACTCAATTACCGG + Exonic
972831502 4:42819361-42819383 AAATGCAAAGGCTCTGGTATAGG + Intergenic
972838121 4:42900044-42900066 CAAGGCAAACGTTCTTTTGCTGG + Intronic
972961094 4:44452663-44452685 AATTGCAAAGGCTCTGGTACTGG - Intergenic
975024439 4:69531420-69531442 ACAGGCAAGGGCTCTGTAACAGG + Intergenic
981464032 4:145046035-145046057 AAAAGCAAATGCCCTGTTACAGG + Intronic
984767299 4:183409350-183409372 CAAGGCAAATCCTCAGTAACTGG + Intergenic
989078016 5:37585721-37585743 CATGGGTCAGGCTCTGTTACTGG + Intronic
991128002 5:63089288-63089310 AGAGACAAGGGCTCTGTTACTGG + Intergenic
992390913 5:76330206-76330228 CCTGGCAATGGCTCTGTGACTGG - Intronic
992940947 5:81760725-81760747 CAAGGCAAAGGCCCTGAGGCTGG - Intergenic
994445299 5:99864585-99864607 CAAGGCAAAGACTCTGTTTATGG - Intergenic
996628066 5:125594295-125594317 CAAGGCAAAGGCCCTGAGGCAGG + Intergenic
997349265 5:133218625-133218647 CAAGGCAAAGGCCCTGGTGCAGG - Intronic
998847898 5:146328606-146328628 GAAGGCAAAGGTTCTGAGACGGG + Intronic
999001888 5:147932637-147932659 CAAGACAAGGGCTCAGGTACAGG + Intergenic
999302875 5:150501963-150501985 CAGGGCAAAGGCGCTGGAACTGG + Intronic
1000235557 5:159356386-159356408 AAGGGCAAAGGCTCTGAGACAGG - Intergenic
1002700791 5:181123205-181123227 TAAGGCACAGGGTCTGGTACTGG + Intergenic
1003732739 6:8844086-8844108 CAATGGAAAGGCTCTGCCACCGG - Intergenic
1004114237 6:12750259-12750281 CAAGGAAAAGGTTCCGTTCCAGG - Intronic
1006996886 6:38269639-38269661 CCAGGCAAAGGCTCTGCAAAGGG + Intronic
1010897060 6:81377738-81377760 CAAGGCAAGGGCTGGGCTACAGG - Intergenic
1012814827 6:104010192-104010214 CAAGGGAAAGGGTGTATTACAGG - Intergenic
1017517179 6:155167039-155167061 CAAGTCAAAGGAACTGATACTGG - Intronic
1018538147 6:164846009-164846031 CAAGGGAGAGGCTGTGTTCCAGG + Intergenic
1018834921 6:167475754-167475776 CAAAGCAAAGCTTCTGTTATAGG - Intergenic
1020909613 7:14112111-14112133 CAATGCAAAGGCTCTGATGTGGG - Intergenic
1021388412 7:20061128-20061150 CAAGGTAAGGGCTCTCTTTCTGG + Intergenic
1024047429 7:45594459-45594481 GAAGGCAAAGGCTCTTTTTGTGG + Intronic
1030503628 7:110391251-110391273 CAAGGCAAAGCAGCTGTTAGAGG - Intergenic
1032504063 7:132422730-132422752 CAAGGCCCAGGCCCTGTTCCAGG + Intronic
1033578806 7:142712855-142712877 CAAGGCGTAGGTTCTCTTACAGG + Intergenic
1035032284 7:155869398-155869420 CAAGTCATACGCTCTGTTCCTGG - Intergenic
1036293521 8:7517015-7517037 AAAAGCAAGGGCTCTGTTCCAGG - Intergenic
1036329040 8:7803980-7804002 AAAAGCAAGGGCTCTGTTCCAGG + Intergenic
1037776795 8:21840942-21840964 CAAGGCAAGGTCCCTGTTCCTGG - Intergenic
1038425793 8:27463074-27463096 CAAGGCTGAGGCTCTGCTGCAGG - Exonic
1041450380 8:58000137-58000159 CCATGCAAAGGCCCTGTGACAGG + Intronic
1044892609 8:96853278-96853300 CAAGGCCAGGGCGCTGTGACAGG + Intronic
1045874836 8:106968039-106968061 AAAGGCAAAGGCTCAGTAATGGG - Intergenic
1046655759 8:116892391-116892413 AAATGCAAAGGCTCTGAGACAGG + Intergenic
1047818634 8:128493794-128493816 CAAGGCAGAGGCCCAGTCACTGG - Intergenic
1048269887 8:133020223-133020245 AAAGCCAAACTCTCTGTTACTGG - Intronic
1048341414 8:133541835-133541857 CAAGGGAAAGGGTCTGAAACTGG + Intronic
1049224660 8:141444499-141444521 TAAGGAAAAGGCTTTGTTAGTGG + Intergenic
1049638270 8:143701063-143701085 CAAAGCCAAGGGTCTTTTACAGG - Intronic
1050176934 9:2877962-2877984 CAAGGCAGAGGTTCAGATACAGG + Intergenic
1051175409 9:14355106-14355128 AAAGGGAAAAGCTGTGTTACAGG + Intronic
1055549690 9:77421281-77421303 CAAGGCAGAGGCTGTGTAACAGG - Exonic
1055874297 9:80923721-80923743 TAATGCAAAGGCTCTGAGACTGG + Intergenic
1060215166 9:121734593-121734615 AAAGGAAAAGGCCCTGTTATGGG + Intronic
1187439631 X:19306540-19306562 CAAGGCAAAGACTGAGTCACGGG - Intergenic
1192223543 X:69213400-69213422 CAATGCAAAGGCTCTGAGGCAGG + Intergenic
1192494514 X:71606134-71606156 CAAGGCAAAGGCACTGGAAATGG + Intronic
1194443452 X:93960325-93960347 CAAGTCAATGGCTGTGTAACAGG - Intergenic
1194717809 X:97307176-97307198 CAAGGCAAGGGTTTTGTAACTGG - Intronic
1195713212 X:107792094-107792116 AGAGCCAAAGGCTCTGTTATTGG - Intronic
1197796614 X:130305264-130305286 CTATGCAGAGGCTCTGCTACTGG + Intergenic