ID: 1154232650

View in Genome Browser
Species Human (GRCh38)
Location 18:12571560-12571582
Sequence GGTTGCAATCAGTGTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154232650 Original CRISPR GGTTGCAATCAGTGTCAGCA TGG (reversed) Intronic
900054555 1:619630-619652 GGTTGCTATTGGTCTCAGCAAGG - Intergenic
902552652 1:17228764-17228786 GGTTTCCCTCAGTGTCAGCCTGG + Exonic
903662393 1:24986160-24986182 GGTTGAAATCAAAGTAAGCATGG - Intergenic
905253086 1:36662308-36662330 GTCTGCAATCAGTGTCATCAAGG + Intergenic
908192412 1:61716994-61717016 TGCTGAAATCAGTGTTAGCATGG - Intronic
910980081 1:92951459-92951481 GGTTGAAATCAGTGTCACCAGGG - Intronic
911281129 1:95930534-95930556 GGTTGTAATGAGGGTCAGCTAGG - Intergenic
913154716 1:116084677-116084699 GGCTGCAGGCTGTGTCAGCAGGG + Intergenic
914193313 1:145429679-145429701 TGTTGCTATCAGTGTCTGGAAGG + Intergenic
914902109 1:151716464-151716486 GGTTGCCAGCAGCGTCAGTAAGG + Exonic
917478917 1:175393701-175393723 GCTTGGAATCAGGGGCAGCAAGG - Intronic
917977512 1:180249816-180249838 GGGTGCACTCACTGTCACCACGG + Intronic
918005584 1:180539451-180539473 GGTTCCAAACAGTCTCAGCTGGG - Intergenic
924337283 1:242996762-242996784 GGTTGCTATTGGTCTCAGCAAGG - Intergenic
924526389 1:244854974-244854996 GGCTACAACCAGTGGCAGCAGGG - Exonic
1068906956 10:62337343-62337365 AGTTGAAATCAGTGCCAGCATGG + Intergenic
1069688241 10:70333162-70333184 GGTTGCAAGAAGTGTTAGCTTGG + Intronic
1070857627 10:79619898-79619920 GGTTGCCATCAGTAACAGGATGG - Intergenic
1071494852 10:86161222-86161244 GGTAGCAAGGAGTGTCAGGAGGG + Intronic
1075934895 10:126331950-126331972 GGGTGCAACCACTGGCAGCATGG + Intronic
1081112831 11:39158050-39158072 GGTTGCAATGAGAATCAGCTAGG + Intergenic
1088558673 11:111090115-111090137 GGCTGAAATCAATGTCAGCCAGG + Intergenic
1090280434 11:125451654-125451676 GTTAGCCATCAGTGTCAGCTTGG - Intronic
1091020433 11:132094921-132094943 TGTTACAGTCAGTCTCAGCAAGG + Intronic
1092695392 12:11166131-11166153 GCTTTCACCCAGTGTCAGCATGG + Intronic
1097957527 12:65501408-65501430 GCTTTCACTCAGTGTCAGCTGGG - Intergenic
1098188723 12:67925461-67925483 TATAGCAATCAGTGTCAGGAAGG - Intergenic
1100771548 12:97928345-97928367 GGTTGCAATGAGTGAGAGGAAGG + Intergenic
1102402549 12:112642609-112642631 AGTTGCAATCAGAGTCAAAATGG + Intronic
1102662344 12:114540256-114540278 GGCTGAAATCAGTGTCAGTTGGG - Intergenic
1107351962 13:39524248-39524270 GATTACACTCAGTGTAAGCATGG + Intronic
1107977197 13:45701614-45701636 GGTTCCAACCAGTTTCAGCCAGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1111277345 13:85967291-85967313 GGTAGCACTCTGTGTCAGAAGGG + Intergenic
1111754224 13:92372116-92372138 GGCTGAACTCAGTGTCGGCAGGG - Intronic
1114857640 14:26468404-26468426 GGCTGCAATCAGTGTTGGCTGGG - Intronic
1116309226 14:43300521-43300543 GGCTACAACCAGTGGCAGCAGGG + Intergenic
1118998450 14:70858993-70859015 GTTTACTATCAGTGTGAGCAAGG - Intergenic
1119116897 14:72031584-72031606 GCCTCCCATCAGTGTCAGCATGG - Intronic
1120801275 14:88691296-88691318 GGGTGCAAACAGGGTAAGCAGGG + Intronic
1122362529 14:101175890-101175912 GGCTGCAATCAGTGTTGGCTGGG - Intergenic
1122731912 14:103806574-103806596 AGTTGCAATCAGGGCCAGAAGGG - Intronic
1125265850 15:37880100-37880122 TGTTGCAATCTGTGTCCTCATGG + Intergenic
1144768770 17:17747411-17747433 GGCTGCAATTAGTGGCAGCCTGG + Intronic
1146834476 17:36099170-36099192 GGTTGCAAGAAGTGACAGCAAGG - Intergenic
1146849087 17:36206356-36206378 GGTTGCAAGAAGTGACAGCAAGG - Intronic
1150130941 17:62668651-62668673 GGTTGCAGCCAGTCTCTGCAGGG + Intronic
1150526220 17:65925616-65925638 GTTTGCAATCGTAGTCAGCATGG + Intronic
1151164163 17:72189914-72189936 GGTTGCCAGCAATGTCAACATGG + Intergenic
1151379114 17:73712713-73712735 AGTTCTCATCAGTGTCAGCAAGG + Intergenic
1152445772 17:80342163-80342185 GGCTGCAAGCCGTGACAGCATGG - Intronic
1153117652 18:1679023-1679045 GCTAAAAATCAGTGTCAGCAGGG + Intergenic
1154232650 18:12571560-12571582 GGTTGCAATCAGTGTCAGCATGG - Intronic
1156201605 18:34838892-34838914 GGTGACAAGCAGTCTCAGCAAGG + Intronic
1158433524 18:57415619-57415641 GTTTGCACACAGTGTGAGCAGGG - Intergenic
1164927482 19:32141323-32141345 CGCTGCAGTCAGTGTCAGCCAGG - Intergenic
926271743 2:11371943-11371965 GATAGCACTCAGCGTCAGCAGGG - Intergenic
928189640 2:29151360-29151382 GATTACAACCAGTGTCGGCAAGG - Intronic
928279316 2:29930167-29930189 GAGTGAAATCAGTGTCAGAAGGG + Intergenic
934748166 2:96773406-96773428 GGTTGGCATCAGTGTCAACTGGG - Intronic
936025975 2:109031473-109031495 GGCTTCAATCAGTAGCAGCAGGG + Intergenic
943325574 2:186493660-186493682 GTCTGAAATTAGTGTCAGCAGGG + Intronic
943855867 2:192789386-192789408 GGGTAAAATTAGTGTCAGCAGGG - Intergenic
945111228 2:206361783-206361805 TGTTGCAATAAATGTCAGCATGG + Intergenic
1169122898 20:3107907-3107929 GCGTGCAGTCAGCGTCAGCACGG - Exonic
1169502364 20:6173258-6173280 GGCTGCGATCAGAGACAGCAAGG + Intergenic
1169734005 20:8817322-8817344 GGTGTCTATCAGTGTCAGCTTGG + Intronic
1172809945 20:37640342-37640364 GGTTGCAATCAGTCCCAGAAAGG + Intergenic
1173054048 20:39594306-39594328 GGTTGCAATCAAGGTCAGTCAGG + Intergenic
1173817155 20:45997127-45997149 GGTTGGAGTCAGGCTCAGCAGGG + Intergenic
1173991091 20:47304144-47304166 GGTTGCAACCTGTGTTATCATGG + Intronic
1174125032 20:48298072-48298094 GGCTGCAAACAGTATCAGCTGGG + Intergenic
1174406247 20:50305189-50305211 GGTTGAAAACTGTGTCACCAGGG - Intergenic
1178697427 21:34806298-34806320 TCTTTCAATCAGTGTTAGCATGG - Intronic
1181462861 22:23095571-23095593 GGAGGCACTCAGTGCCAGCAGGG - Exonic
1183004185 22:34886881-34886903 TGATGCCATCTGTGTCAGCAAGG - Intergenic
949093697 3:60775-60797 AGTTGAAATCAGTGTCAGAAGGG - Intergenic
950808449 3:15628565-15628587 AGTTTCAATGAGTGTCAGCAAGG - Intronic
956118955 3:65946514-65946536 GGTGGCAATGACTTTCAGCATGG + Intronic
956366165 3:68505546-68505568 GGGTGCAATCAGTGCCAGCTGGG + Intronic
958745840 3:98133006-98133028 GTTTGCAATCAGTGTAACCACGG + Exonic
958747088 3:98149694-98149716 GTTTGCAATCAGTGTAACCACGG + Exonic
969085181 4:4651272-4651294 GGTTGAAATCAGTGTCAAGTTGG - Intergenic
981347978 4:143698413-143698435 GGTTGCCATCTGTGTCAGTCGGG + Exonic
987226583 5:15847973-15847995 GACTGCAATCAGTGTTAGCTGGG - Intronic
987878488 5:23711314-23711336 GGTAGCTCTCTGTGTCAGCATGG - Intergenic
988923848 5:35969408-35969430 AGTTCCAATGAGTATCAGCAAGG - Intronic
989433366 5:41381616-41381638 GTCTGAAATCAATGTCAGCAGGG - Intronic
989797363 5:45492562-45492584 GGTTGCAGTGAGTGCCAGCCTGG - Intronic
992950807 5:81856373-81856395 GGCTGTAATCAGAGTCATCACGG + Intergenic
999401751 5:151269720-151269742 GGTTGCAGTGAGTTTCAGCATGG - Exonic
1002449911 5:179312827-179312849 GGCTGAAATCAGTTTCAACAGGG - Intronic
1003750739 6:9052407-9052429 GGTTGCCTTCTGTGTGAGCAGGG + Intergenic
1005382215 6:25247454-25247476 GGTTGCTATCCTTGTCTGCATGG - Intergenic
1010517691 6:76792873-76792895 GATAGGAATCAGTCTCAGCAAGG + Intergenic
1013329062 6:109080514-109080536 GGTTCAAATCAGTTTCAACATGG + Intronic
1017410187 6:154159881-154159903 GGGTGTCATCAGTGTCATCAGGG + Exonic
1020498124 7:8882223-8882245 GGTTCCACTCAGTATCAGCTGGG - Intergenic
1022708558 7:32830437-32830459 AGTAGAAACCAGTGTCAGCAAGG + Intergenic
1027751709 7:82156242-82156264 AGTTACAATCAGTGTCATCATGG + Intronic
1028090642 7:86696469-86696491 GGCTAAAACCAGTGTCAGCAGGG - Intronic
1030984416 7:116224185-116224207 GTTTGCAATCGGGGTCAGCTGGG - Intronic
1031771416 7:125848733-125848755 GGTTGCAATCAGAATCACCTGGG + Intergenic
1032059794 7:128715058-128715080 GGTTGCATTCAGAGTAAGGAAGG + Intronic
1033790504 7:144787323-144787345 CCTTGCAATCACTGTCAGCCAGG - Intronic
1033819903 7:145122850-145122872 GATTGACATCAGTGTCAGCCAGG + Intergenic
1034000761 7:147410096-147410118 GGCTGCAATGAATGTCTGCATGG - Intronic
1037522060 8:19689415-19689437 GGTTCCATGCAGTGTCAGCTGGG - Intronic
1038324663 8:26563673-26563695 GATTGCAGTCAGTGCCATCAAGG - Intronic
1039411061 8:37355577-37355599 TGTTGCAATCTGTGTCAGAAAGG - Intergenic
1043510680 8:80947287-80947309 GGCTAAAATCAGTGTCAACAAGG + Intergenic
1044942725 8:97359927-97359949 GGCTGAAACCAGAGTCAGCAGGG - Intergenic
1051208545 9:14715872-14715894 GATTGTAATCAGTGTCTGGAAGG - Intergenic
1056809327 9:89752182-89752204 GGTTGCCACCAGGGTCAGCCTGG - Intergenic
1057388591 9:94625172-94625194 GGTTACAGTCAGTGTCAGGGTGG + Intronic
1059554213 9:115262626-115262648 GTATGCAATCAGTGTCTGCTGGG - Intronic
1059661050 9:116400437-116400459 GGTGGCAATCAGTGGTAGTAGGG + Exonic
1059871146 9:118578874-118578896 GTTTGCAATTATTATCAGCAGGG + Intergenic
1060230007 9:121819301-121819323 GGGAGCAGGCAGTGTCAGCAAGG + Intergenic
1203605408 Un_KI270748v1:53936-53958 GGTTGCTATTGGTCTCAGCAAGG + Intergenic
1189333164 X:40155196-40155218 AGTTGCAATCAGTTTCCGAAAGG + Intronic
1197562092 X:128036234-128036256 AGCTAAAATCAGTGTCAGCAGGG + Intergenic
1201676313 Y:16588652-16588674 GGTTATCATCAGTGTCAGTAAGG + Intergenic