ID: 1154235993

View in Genome Browser
Species Human (GRCh38)
Location 18:12606289-12606311
Sequence CAGTGCCTAAAACAACTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154235993 Original CRISPR CAGTGCCTAAAACAACTGTC TGG Intronic
903618218 1:24678129-24678151 CTGGGGCTAAAAGAACTGTCAGG - Intergenic
909090985 1:71225297-71225319 GCGTGACTAAAACAACAGTCAGG + Intergenic
912210715 1:107554062-107554084 CAGAGCCAAGAACAACTCTCTGG + Intergenic
916500345 1:165381715-165381737 CAGTGACTAAAAGAACTTCCAGG + Intergenic
918077078 1:181178537-181178559 AAGTGCCTGCAACCACTGTCAGG + Intergenic
920525812 1:206665068-206665090 CAGTGCATAAAAGAAATGTCCGG - Intronic
920586390 1:207166816-207166838 AAGTTCCTAAAAGAACTTTCTGG - Intergenic
922724230 1:227915043-227915065 CAGTGCATACAGCAACTGGCTGG - Intergenic
1065454210 10:25890347-25890369 CAGTGTCTAAAATCACTGTGAGG - Intergenic
1068315454 10:55336196-55336218 CAGGGCATAAAACAATTCTCTGG + Intronic
1069198192 10:65580831-65580853 CAGAACTTAAAACAGCTGTCTGG - Intergenic
1070185917 10:74062464-74062486 CAGTGCCTAATACCATGGTCTGG - Intronic
1071882319 10:89912803-89912825 CAATGCCTAAAATAACAATCAGG + Intergenic
1073097045 10:100986178-100986200 CAGAACATATAACAACTGTCAGG - Intronic
1078494220 11:11799816-11799838 CAGTTCCTAAAACATAAGTCTGG - Intergenic
1079156044 11:17949064-17949086 CAGTCCCTCTAACAACTGGCTGG + Intronic
1080652027 11:34230424-34230446 CAATACCTAAAATAACTTTCGGG + Intronic
1081081728 11:38749442-38749464 CAGGCCATAAAACAACTTTCAGG - Intergenic
1084712138 11:70850479-70850501 CAGTCCCTAAAGCACCTGTGAGG + Intronic
1086053531 11:82621440-82621462 GAGTTCCTAAAACAACCCTCAGG - Intergenic
1086559161 11:88147243-88147265 CAGTGCCCAGAACATTTGTCTGG + Intronic
1089027665 11:115288781-115288803 CAATGCCTAAAAAAAGTTTCTGG + Intronic
1089323823 11:117643989-117644011 CAGTCCATAAAACTACTGTCGGG + Intronic
1093656128 12:21695737-21695759 CAGTTCCTACAACAAATTTCTGG - Intronic
1093865569 12:24222945-24222967 CAGTGGGTGATACAACTGTCCGG + Intergenic
1097390370 12:59004714-59004736 CAGTACGTAAAACAAATGTGTGG + Intergenic
1097720919 12:63020263-63020285 CAGTGCCTTAAACTAGTGACAGG - Intergenic
1098527273 12:71500328-71500350 CAGGGCTGAAAACAACTGTCTGG - Intronic
1105295310 13:19084031-19084053 CAGTGCTAAAAAGAACTATCAGG + Intergenic
1107964579 13:45587573-45587595 CTCTGCCCAAAACAACTGTGAGG - Intronic
1113683747 13:112263230-112263252 CAGTGCTGAAGAGAACTGTCAGG + Intergenic
1115377759 14:32696824-32696846 CAGTGCCTGCAAAAGCTGTCAGG + Intronic
1117532539 14:56673718-56673740 CAGCACCTACAACAAGTGTCTGG + Intronic
1117854169 14:60010163-60010185 CAGTGCCAAAAAGAAATGTGGGG - Intronic
1119162563 14:72465256-72465278 CAGTGCCTAAAAGCTCTGCCTGG - Intronic
1119910303 14:78343914-78343936 CACTGCCTAATAGAACTGCCAGG - Intronic
1124453926 15:29822843-29822865 CAGTGAAGGAAACAACTGTCGGG - Intronic
1125729957 15:41887560-41887582 CAGGGCCTCAGATAACTGTCGGG - Intronic
1128614367 15:69097795-69097817 CAATGCCTAAAAGAAGTGACTGG + Intergenic
1129108800 15:73325607-73325629 CTGTGCTCAAAACAACTGCCCGG + Intronic
1130874107 15:87997219-87997241 CAGTGCTTCATACAATTGTCTGG + Intronic
1137042794 16:35628793-35628815 CTGTGCCTAAAACAACTGTGGGG + Intergenic
1137389715 16:48071150-48071172 CAGGGCCTAGCACATCTGTCTGG - Intergenic
1138930601 16:61651262-61651284 CAGTGTCTAAAACAAGTGCTTGG - Exonic
1139113014 16:63915606-63915628 AAATGCCTGACACAACTGTCTGG - Intergenic
1139243765 16:65420534-65420556 AAATGCCTAAAATAATTGTCTGG - Intergenic
1141533591 16:84663384-84663406 CAGTTCCTAAAGCAGGTGTCAGG + Intronic
1149250661 17:54765268-54765290 TAGTGCCTAGAAAAAGTGTCTGG + Intergenic
1153408094 18:4762544-4762566 CAGTGGATAAGACAACAGTCTGG + Intergenic
1154235993 18:12606289-12606311 CAGTGCCTAAAACAACTGTCTGG + Intronic
1155842867 18:30668058-30668080 CAGTGCCAAAAAGAAATGTGGGG - Intergenic
1156921088 18:42523110-42523132 CAATAAATAAAACAACTGTCAGG - Intergenic
1158358573 18:56647315-56647337 TAGTGCCTAAAACCACTGGATGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1158623972 18:59056140-59056162 CAGAGCCTGAGACAAATGTCCGG - Intergenic
1159366205 18:67468812-67468834 GATTGCCTAAAACAACTGTGAGG + Intergenic
1166122370 19:40693303-40693325 CAGTGCAAGAAACAAGTGTCAGG + Intronic
1166154235 19:40898783-40898805 CAGGGCATAAACCAACTGGCTGG + Intergenic
934129504 2:88934401-88934423 CTGTTCCTACAACAACTATCTGG - Intergenic
934134335 2:88981170-88981192 CTGTTCCTACAACAACTGTCTGG - Intergenic
934145297 2:89087587-89087609 CTGTGCCTACAACAACTACCTGG - Intergenic
934745970 2:96760205-96760227 CAGAGCCTAGAACAAGTGCCTGG + Intergenic
935411931 2:102773165-102773187 CAGAACCTAAAATAAGTGTCTGG - Intronic
936376454 2:111945535-111945557 CAGTGCCCAAAAGAAGTCTCAGG - Intronic
937503412 2:122508777-122508799 CAGTGCCTAATTCTTCTGTCAGG - Intergenic
937730594 2:125224432-125224454 CTGGGCCTGAAAAAACTGTCCGG - Intergenic
939549262 2:143593253-143593275 CAGTACCTAAACCAGCTGACAGG - Intronic
941998439 2:171623452-171623474 CATTGCCCTAAACAATTGTCAGG + Intergenic
942794207 2:179796972-179796994 AAGTGACTAGAGCAACTGTCTGG + Intronic
1175362281 20:58422096-58422118 CAGGGCCTAAAGCAACTCTTTGG - Intronic
1175628194 20:60507383-60507405 CAGTGCTTTAAAGAACTGCCTGG + Intergenic
1183020423 22:35022106-35022128 CAGTGCCTAAAACAATGCTCGGG - Intergenic
1183838422 22:40476837-40476859 CTGTGCCAAAAACATCTCTCTGG + Intronic
1185129576 22:49031538-49031560 CAATGCTTAAAATAATTGTCAGG + Intergenic
951283341 3:20779595-20779617 CCCTGCTTAAAGCAACTGTCTGG - Intergenic
952157908 3:30663797-30663819 AAGTGCATAAAACAAGTGTCTGG - Intronic
952651618 3:35734478-35734500 CAGTGACAAAATCAACTGTTTGG - Intronic
956218856 3:66880737-66880759 AAATGCATAAAGCAACTGTCAGG - Intergenic
956412091 3:68990102-68990124 AAGTGCCCAAAAAAACTGCCTGG - Intronic
960155623 3:114294802-114294824 CAGTGCCTGAAAAAACCTTCAGG - Intronic
960526915 3:118720451-118720473 CAGTGCCTAAAAGACCTGCCAGG - Intergenic
964618856 3:158700355-158700377 CAGAGCTTAAAACAAATGTTAGG + Intronic
964793127 3:160471408-160471430 CAGTGCCAAAAAGAAATGTGGGG + Intronic
966504812 3:180687787-180687809 CAGAGCCTCAAAAAACTGACCGG + Intronic
967659705 3:192091613-192091635 CAGTGCATGAAACCCCTGTCAGG - Intergenic
967842161 3:194014921-194014943 CATTCCCTAGAACAGCTGTCTGG - Intergenic
980434519 4:132751161-132751183 CAGTGCCTTACACAATTGTTGGG - Intergenic
985959756 5:3292263-3292285 CAGTGGTTAAAACAAGTGACCGG + Intergenic
988639906 5:33030378-33030400 CACTGCCTGAAAGAACTTTCTGG + Intergenic
990346530 5:54877008-54877030 CAGTGCCTAGAACAAGTGCCTGG + Intergenic
991491403 5:67187327-67187349 CAGTGCTTAAAAAAACTAGCAGG + Intronic
993793277 5:92233743-92233765 CAGTGCCTAAAGCAATTAACAGG - Intergenic
994754042 5:103773133-103773155 CAGTTCCTAAAACATATATCAGG + Intergenic
994760419 5:103845134-103845156 CAGAGCTTCAAACAACTATCTGG - Intergenic
995607780 5:113876267-113876289 CAGTGCCTATAGCATGTGTCGGG + Intergenic
995686154 5:114774421-114774443 CAGTGACACAAACACCTGTCTGG + Intergenic
1000973279 5:167737912-167737934 CAGTGCCCTATAGAACTGTCTGG - Intronic
1004624233 6:17359745-17359767 CAGTACCAAAAATTACTGTCAGG - Intergenic
1004995452 6:21187216-21187238 ACTTGCCTAAAACAACTGGCAGG + Intronic
1005774015 6:29109439-29109461 CAATGCCTGAAAGAAATGTCAGG - Intergenic
1006495925 6:34423475-34423497 GAGTGGCAAAAACAAATGTCAGG + Intronic
1006872891 6:37269367-37269389 CAGTGCCTTACACACCTGTCAGG - Intronic
1007619145 6:43201126-43201148 CAGTGCCTGACACAAATGCCTGG - Intronic
1010888694 6:81276822-81276844 CAGTGCCTAGAAATAGTGTCTGG - Intergenic
1011161419 6:84394565-84394587 TAGTGCCTAGCACAAATGTCTGG + Intergenic
1011638879 6:89401062-89401084 CAGTGCCTAGAACACCTAGCTGG - Intronic
1011717118 6:90118400-90118422 CAGTGATTAAAACAGCTCTCTGG + Intronic
1013700966 6:112768907-112768929 CAGAGCCAAAAAAAACTATCTGG - Intergenic
1015685252 6:135851695-135851717 CAGTGCCCAGACCAACTGACTGG - Exonic
1017588525 6:155953292-155953314 CAGTGCCTGAAATCACTATCTGG - Intergenic
1018287286 6:162254509-162254531 CAGTGCCTCAAACAACACACTGG - Intronic
1024476576 7:49818464-49818486 CAGTGCTTAAAACATCAGACTGG - Intronic
1025710108 7:63900747-63900769 AAGTGCCTGAAACAACGGGCGGG - Intergenic
1030920591 7:115380749-115380771 CAATGTCTAAAACAATTCTCAGG + Intergenic
1037229984 8:16646428-16646450 GAGTGCTCAAAACAAGTGTCGGG + Intergenic
1041314598 8:56547711-56547733 CAGTGCCTGACAGAACAGTCAGG + Intergenic
1044170094 8:89040397-89040419 CAGTTCCTAAGACAACAATCAGG + Intergenic
1044942508 8:97357521-97357543 CTGTGCCTTAAAGAACTGTGTGG + Intergenic
1050334730 9:4579615-4579637 CAGAGCCAATAACAACTGTGAGG + Intronic
1051068792 9:13137294-13137316 CAGTGCCTAACGCAAATGACTGG + Intronic
1051476978 9:17518677-17518699 CATTGCCTAAAACAAGTCACAGG - Intergenic
1052375164 9:27711032-27711054 CATTGCCCAAAACAAGGGTCTGG - Intergenic
1056812081 9:89772667-89772689 CTGTGCCCAAAACAAGTGTGGGG + Intergenic
1057264538 9:93605735-93605757 CAGTGCTAAAAAGAACTATCAGG - Intronic
1059871876 9:118586968-118586990 CAGTGCAGAAAACAAATGTGGGG + Intergenic
1186382648 X:9077349-9077371 CTGTACCTAAAGCAAATGTCAGG + Intronic
1188213429 X:27450036-27450058 CAGTTACTAAGGCAACTGTCTGG - Intergenic
1189168441 X:38885251-38885273 AAATGCCTAAAAAAAATGTCGGG + Intergenic
1195916723 X:109943325-109943347 CAGTCCCAAAAAGAACTATCAGG - Intergenic