ID: 1154241392

View in Genome Browser
Species Human (GRCh38)
Location 18:12657387-12657409
Sequence GTCCCCGCCGGATCCTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154241374_1154241392 24 Left 1154241374 18:12657340-12657362 CCGAGGGGCCCCGGCCAGCCACG 0: 1
1: 0
2: 2
3: 20
4: 273
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1154241373_1154241392 27 Left 1154241373 18:12657337-12657359 CCTCCGAGGGGCCCCGGCCAGCC 0: 1
1: 0
2: 3
3: 31
4: 327
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1154241376_1154241392 16 Left 1154241376 18:12657348-12657370 CCCCGGCCAGCCACGGCCTGACG 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1154241378_1154241392 14 Left 1154241378 18:12657350-12657372 CCGGCCAGCCACGGCCTGACGCC 0: 1
1: 0
2: 1
3: 20
4: 204
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1154241381_1154241392 0 Left 1154241381 18:12657364-12657386 CCTGACGCCGTCCTCCCCTGCGG 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1154241379_1154241392 10 Left 1154241379 18:12657354-12657376 CCAGCCACGGCCTGACGCCGTCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1154241384_1154241392 -7 Left 1154241384 18:12657371-12657393 CCGTCCTCCCCTGCGGGTCCCCG 0: 1
1: 1
2: 3
3: 29
4: 306
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1154241377_1154241392 15 Left 1154241377 18:12657349-12657371 CCCGGCCAGCCACGGCCTGACGC 0: 1
1: 0
2: 1
3: 21
4: 181
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1154241380_1154241392 6 Left 1154241380 18:12657358-12657380 CCACGGCCTGACGCCGTCCTCCC 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154241392 Original CRISPR GTCCCCGCCGGATCCTCCCG GGG Intronic
900112747 1:1015442-1015464 TCTCCAGCCGGATCCTCCCGAGG - Intergenic
900242748 1:1624806-1624828 GTCCCCGCCAGGGCCTCCCGAGG + Exonic
902398639 1:16145570-16145592 CTCCCTGCCGGACCCTCCCCAGG - Intronic
905449247 1:38046498-38046520 GCCGCCGCCGCCTCCTCCCGTGG + Exonic
906355686 1:45105193-45105215 CTCCCCGCCTCAGCCTCCCGAGG + Intronic
915655623 1:157357386-157357408 TTCCCCTGGGGATCCTCCCGAGG + Intergenic
924624819 1:245689023-245689045 GTCCCCGGCGGAGCCCCGCGGGG - Intronic
1065268547 10:24002499-24002521 GTCCCCGCCAGAGCCTCTGGTGG - Intronic
1070112034 10:73495823-73495845 GCCCCCGCCGCCCCCTCCCGGGG - Exonic
1077297369 11:1832480-1832502 CTCCCTGCCTGAGCCTCCCGGGG - Intronic
1077440624 11:2567062-2567084 GTCTCCCCCAGAGCCTCCCGTGG - Intronic
1081606135 11:44528184-44528206 GCCCCAGCCTGATCCTCCCCCGG + Intergenic
1085119328 11:73957181-73957203 CTCCCCGCCTGATGCTCCCCTGG - Intronic
1096503563 12:52079848-52079870 GTCGCCGCCGGAGCCCCCCGAGG + Intergenic
1104989582 12:132618402-132618424 GTCCAGGCCGGTTCCTGCCGCGG - Intergenic
1105438082 13:20394431-20394453 GTCCCTGCCGCATCCTCCGAGGG - Intergenic
1113831320 13:113297618-113297640 GTCCCGGCCGGCTCTGCCCGCGG + Intronic
1119485621 14:74984849-74984871 GTCCCCTCCTGCTCCTCCTGGGG + Intergenic
1122272837 14:100575997-100576019 TTCCCCGCCTGCTCCTCCAGGGG - Intronic
1124169351 15:27358963-27358985 CGCCCCGCCGGGTCCTCCCCAGG - Intronic
1128326833 15:66729430-66729452 GACCCGGCCGGCTGCTCCCGGGG - Intronic
1128501413 15:68229714-68229736 AGCCCCGCCTGTTCCTCCCGAGG - Exonic
1131641253 15:94296483-94296505 GTCCTCACCGCAGCCTCCCGAGG + Intronic
1132526451 16:418159-418181 CTCCGCGCCGGGTCCTCCTGGGG + Intergenic
1132642343 16:983577-983599 GTGCGCTCCGGAGCCTCCCGTGG - Intronic
1132865217 16:2089857-2089879 GCGCCCGCCGGATCTTCCCGTGG - Exonic
1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG + Intergenic
1136344223 16:29664681-29664703 GTCGCCCCCGGACCCTCCCACGG - Exonic
1141667288 16:85472395-85472417 GTCCCTGCCTTCTCCTCCCGCGG + Intergenic
1143183395 17:4997562-4997584 CCGCCCGCCGGCTCCTCCCGCGG - Intronic
1148805390 17:50261271-50261293 CTCCAGGCCGGATGCTCCCGTGG - Intergenic
1152890113 17:82875605-82875627 GGCCTCGGCGGATCCTCCCTGGG - Intronic
1152924543 17:83081043-83081065 GCCCCCGGCGGAGCCTCCCCGGG + Intronic
1154012728 18:10589372-10589394 GTCTCCGCGGAAGCCTCCCGCGG - Intergenic
1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG + Intronic
1157384053 18:47247480-47247502 GTCCCCGCCGCTGCCGCCCGGGG + Intronic
1158857149 18:61554345-61554367 GCCCCCGCCTGCGCCTCCCGGGG - Exonic
1160586302 18:79915319-79915341 GTCCCCTCCCCATCCCCCCGGGG + Intronic
1161241050 19:3224408-3224430 GTCCCCGCCGGCTCCCGCGGAGG - Intergenic
1163210495 19:15836638-15836660 ATCCCCCCATGATCCTCCCGTGG + Intergenic
1165978828 19:39702414-39702436 CTCCCCCCCGGATCATCCTGAGG + Intergenic
1166792171 19:45404922-45404944 GTCCCCTCCCAATCCTCCCAGGG + Intronic
1167145819 19:47680472-47680494 GGCCCCGCCGCAGCCCCCCGGGG + Exonic
925970883 2:9105925-9105947 GTCCCAGCCAGATCATCCCCAGG + Intergenic
927895323 2:26778092-26778114 ATCCCCGCCGGCTCCTTCAGCGG + Exonic
942277875 2:174335996-174336018 GTCCCCTGCGGCTGCTCCCGGGG - Intronic
947592885 2:231395445-231395467 GTCCCTGGCGGAGCCTCCCGGGG - Intergenic
1175111169 20:56649082-56649104 GTCCCAGCTGCATTCTCCCGAGG + Intergenic
1176024270 20:62977910-62977932 GGTCCCTCCTGATCCTCCCGTGG - Intergenic
1178638577 21:34327335-34327357 GTCAACGCAGCATCCTCCCGGGG + Intergenic
1179558032 21:42193181-42193203 GTCCCCGCAGGAGGCTCCAGGGG + Intergenic
1180877944 22:19183799-19183821 GTCCCCTCCAGAGCCTCCGGAGG - Intronic
1183501394 22:38181690-38181712 GTCTCCGCCGGACCCTCCTTTGG - Exonic
1185302797 22:50091270-50091292 GTCGCCCCAGGTTCCTCCCGTGG + Intronic
954367515 3:50154538-50154560 GGCACCGCCGGACCTTCCCGCGG - Intergenic
954378320 3:50206183-50206205 GTCCCCGCAGGTCCCTCCCCTGG - Intronic
954803049 3:53198505-53198527 GTCCCAGCCGTTTCCTCACGGGG - Intergenic
963139299 3:141934307-141934329 GTCTCAGCCAGCTCCTCCCGTGG - Intergenic
968025916 3:195442614-195442636 GTCCCCACCGAGCCCTCCCGAGG - Intronic
968642556 4:1721762-1721784 GTCCCCCACGGCTCCTCCTGGGG + Intronic
977400115 4:96521408-96521430 GTCCCCGCCGTGGGCTCCCGTGG + Intergenic
982352446 4:154430489-154430511 GACCCCACAGGATCCTCCCTGGG + Intronic
985709641 5:1421074-1421096 GTCCCTGCGGGAGGCTCCCGTGG + Intronic
988856129 5:35229741-35229763 TTCCCCGCCGGATGCCCGCGAGG + Intronic
998130867 5:139650468-139650490 GCCCCCGCCGGAGCCGCCCCAGG + Intronic
1015315072 6:131808093-131808115 TTCCCCGCCGGGCCCTCCCGGGG - Exonic
1019415928 7:926472-926494 CACCCTGCCGGGTCCTCCCGGGG + Intronic
1021310645 7:19091796-19091818 GTCCCCTCCCTATCCTCCAGAGG - Intronic
1024312140 7:47979339-47979361 ATCCCGGCCCCATCCTCCCGCGG + Intronic
1033657318 7:143382384-143382406 TTCCCCGCCGCCTCCTCCGGAGG + Exonic
1036910570 8:12754673-12754695 GGCCCCGCCGCATCCCCGCGCGG + Intronic
1039566230 8:38554243-38554265 TTCCCCTCCGGAGCCTCCCGGGG + Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1049145891 8:141000979-141001001 GTCTCCGCCGCATCCGCCCCGGG + Intronic
1049638909 8:143705530-143705552 GTCCCCCCCAGCACCTCCCGGGG - Intronic
1057208190 9:93185356-93185378 GTCGCCGCCGCCTCCTCCCTGGG - Exonic
1062185894 9:135218244-135218266 GTCCTCCCCGGCTCCTCCGGGGG + Intergenic
1192575279 X:72238763-72238785 GTGGCCCCCGGATCCTCCTGGGG - Intronic