ID: 1154241827

View in Genome Browser
Species Human (GRCh38)
Location 18:12659125-12659147
Sequence ACTCTGTAGGGCTTTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154241827_1154241830 0 Left 1154241827 18:12659125-12659147 CCTGTGTGAAAGCCCTACAGAGT No data
Right 1154241830 18:12659148-12659170 GTTGAAAGCATCAACCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154241827 Original CRISPR ACTCTGTAGGGCTTTCACAC AGG (reversed) Intronic