ID: 1154241827

View in Genome Browser
Species Human (GRCh38)
Location 18:12659125-12659147
Sequence ACTCTGTAGGGCTTTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154241827_1154241830 0 Left 1154241827 18:12659125-12659147 CCTGTGTGAAAGCCCTACAGAGT 0: 1
1: 1
2: 0
3: 7
4: 105
Right 1154241830 18:12659148-12659170 GTTGAAAGCATCAACCAAATAGG 0: 1
1: 0
2: 2
3: 30
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154241827 Original CRISPR ACTCTGTAGGGCTTTCACAC AGG (reversed) Intronic
900733460 1:4278986-4279008 ACCCTGTAGGGCTTTGACTTTGG + Intergenic
901735825 1:11311548-11311570 ACTCTGGAGGGCTGTCTGACAGG - Intergenic
902779595 1:18695974-18695996 TCTCTGTAGTGCTTCCACAATGG - Intronic
903140400 1:21335603-21335625 ACTCTGGAGGGCTCTCACCCAGG + Intronic
909356370 1:74714606-74714628 ACTCTCTCCAGCTTTCACACAGG + Exonic
909557468 1:76969646-76969668 TCTCTTTAGGGCTGTCAGACAGG - Intronic
911072692 1:93845214-93845236 CCTCTGTATGGTTTTCCCACAGG + Intronic
911889363 1:103347497-103347519 ACTCAGTATGTCTTTCACAGAGG - Intergenic
915550859 1:156633178-156633200 AGTCTGCAGGGCTTTCTCAATGG + Intergenic
1067691741 10:48506246-48506268 ACTCTGTGGGGTTTGCACAATGG - Intronic
1069832557 10:71290060-71290082 AGTTTGAACGGCTTTCACACTGG - Intronic
1070130660 10:73653361-73653383 GCTCTGCAGGGCTGTCAGACAGG + Exonic
1070358996 10:75669024-75669046 ACTCTGAAGGGCTTTCATTTTGG + Intronic
1071745184 10:88410395-88410417 ACTCTTTGGGGCTTTTATACTGG - Intronic
1072514299 10:96163889-96163911 ACTTTGTAGCTCTTTTACACAGG - Intronic
1072804985 10:98418533-98418555 ACCCTGCAGGGCTGTCATACAGG + Intronic
1074496379 10:113983383-113983405 CCTCTGTAGGTCTCTCAAACTGG + Intergenic
1080191270 11:29552178-29552200 ACCCTTTGGGGGTTTCACACTGG + Intergenic
1085706553 11:78791551-78791573 CCACTGTGGGGCTTGCACACAGG - Intronic
1085711826 11:78836051-78836073 ACCCTGAAAGGCTTTCTCACTGG - Intronic
1087330165 11:96771520-96771542 ACTCTCATGGGCTTTAACACTGG + Intergenic
1089099325 11:115948086-115948108 ATTCTGATGGGATTTCACACGGG - Intergenic
1091784136 12:3232011-3232033 AGTCTGTAGGGCCTTCACCACGG + Intronic
1094140595 12:27177606-27177628 GTTCTGTAGGTCTTTCACAGAGG - Intergenic
1095392082 12:41719505-41719527 ACTCTCTAGAGGTTTCCCACTGG - Intergenic
1100309585 12:93381907-93381929 ACTATGTCTGGATTTCACACAGG - Intronic
1104565231 12:129875252-129875274 ACCCTGTAGGGCTTTCACACTGG + Intronic
1106256154 13:28023751-28023773 ACTAGGTAGGGCTGTCACAGTGG + Intronic
1106463032 13:29989551-29989573 ACTCTGTGGGGCTGTTTCACAGG + Intergenic
1115374346 14:32656911-32656933 ATTCAGTTGGGCTTTCACTCAGG - Intronic
1117257052 14:53988681-53988703 ACTCTGCAGAGATTTCCCACCGG - Intergenic
1117761895 14:59037896-59037918 ACTCTGTGGGGGTTTAACGCAGG + Intergenic
1118541209 14:66827341-66827363 ACTCTGTACTGCTATCACTCAGG + Intronic
1119409202 14:74418881-74418903 ACTCTGTATGGCATTAACAGAGG - Intronic
1121606909 14:95247238-95247260 ACTGTGAAGGGATTTCACCCAGG + Intronic
1126393453 15:48185039-48185061 ACTCTGTTGCCCTTTCAAACTGG - Intergenic
1127315302 15:57789187-57789209 ACTCTGCAAGGCATTCACAATGG - Intergenic
1134675360 16:16086399-16086421 GCTCTGCAGGGCCTTCACCCAGG + Intronic
1136281434 16:29213732-29213754 ACTCTGTATGGGAATCACACAGG - Intergenic
1137921330 16:52491306-52491328 ACACTGAAGCCCTTTCACACTGG + Intronic
1138455718 16:57119582-57119604 ACTGTGAATGGCTTCCACACAGG - Exonic
1140891507 16:79289172-79289194 ACACTGTAGGGATTTCAAGCAGG + Intergenic
1142085804 16:88179660-88179682 ACTCTGTATGGGAATCACACAGG - Intergenic
1144148629 17:12421927-12421949 TCTCTGTGGGGCTTTCACTGGGG - Intergenic
1144631242 17:16873560-16873582 ATCCTGCAGGGCTTTCACCCAGG + Intergenic
1144649334 17:16997598-16997620 ACCCAGCAGGGCTTTCACCCAGG - Intergenic
1148862301 17:50610900-50610922 AGTCTGTGGGGCCTTAACACAGG + Intronic
1151426395 17:74033537-74033559 ACCCTGTATGGCTTCCAAACAGG - Intergenic
1153330441 18:3868053-3868075 TCTCTCTAAGGCTTTCACAAAGG - Intronic
1154241827 18:12659125-12659147 ACTCTGTAGGGCTTTCACACAGG - Intronic
1157982514 18:52397674-52397696 ACTCTTTGGCCCTTTCACACAGG + Intronic
1159702012 18:71640748-71640770 ACCCTAAAGGGCTGTCACACTGG - Intergenic
1163625098 19:18384761-18384783 CCTCTGTGGGGTCTTCACACTGG + Intronic
1164846562 19:31437795-31437817 CCTCTGTGGGGCTCTCCCACAGG + Intergenic
1164884811 19:31769624-31769646 TGTCTGCAGGGTTTTCACACAGG - Intergenic
926679824 2:15654654-15654676 CCACTGCAGGGCTTGCACACGGG - Intergenic
927289460 2:21391429-21391451 ACTCTGTTGGGATTTGACAGAGG - Intergenic
933996113 2:87671216-87671238 ACTCTGGAGGGCTCTCCCAGAGG + Intergenic
936297742 2:111279696-111279718 ACTCTGGAGGGCTCTCCCAGAGG - Intergenic
941597070 2:167490752-167490774 ACACTGTAGGGCTTTCCAAAAGG - Intergenic
947232354 2:227901357-227901379 CCTCTGTTTGGCTATCACACAGG - Intronic
948824968 2:240569605-240569627 GCTCTGCAGGGCTTGCACACTGG + Intronic
1169317046 20:4601548-4601570 CCACTGGAGGGCTTTCCCACAGG + Intergenic
1170900919 20:20462384-20462406 ACTCCCTAGGGCTGGCACACGGG + Intronic
1172363633 20:34332454-34332476 ACCCTGAAAGGCTGTCACACTGG + Intergenic
1173068089 20:39733813-39733835 ACTATGTAGGCTTTTCAGACTGG - Intergenic
1183617047 22:38952163-38952185 ACTCACTGGGGCTTTCACGCTGG + Intergenic
949396574 3:3620847-3620869 ACCCTGTGGGGCTTTAACAATGG - Intergenic
951577943 3:24132677-24132699 ACCCTGTAGAGCTGTCCCACCGG - Intronic
953533116 3:43755949-43755971 AGTCTGTAGGGCTTCCACGCAGG + Intergenic
954793917 3:53151843-53151865 ACCCTGGAGGGCAGTCACACAGG + Intergenic
957434117 3:80151985-80152007 ACTGGGTAGGGCTTCCATACAGG - Intergenic
960622107 3:119647160-119647182 ACTCTGGAGGCCTTCCTCACTGG + Intronic
960761069 3:121074373-121074395 TCTCTGGAGGGCTTTAACACCGG + Intronic
964300711 3:155282280-155282302 ACTCTCTAGAGTTTTCCCACTGG - Intergenic
967213088 3:187186059-187186081 ACACTGTAGGGCTGCCCCACTGG - Intergenic
968282958 3:197490759-197490781 AATCTGTGGGGCTGTCACTCAGG - Intergenic
969386867 4:6857201-6857223 ACTCTGAAGGTCTTTCAGTCTGG - Exonic
973893873 4:55393681-55393703 ACACTCCAGGGCTTTCTCACAGG - Intergenic
975253108 4:72202257-72202279 AATCTGCAGGGCTTTGACATGGG + Intergenic
979725540 4:123956259-123956281 ACTCAGAAAGGCTGTCACACTGG + Intergenic
983892824 4:173048151-173048173 ACTGTGTATTGCATTCACACGGG + Intergenic
986471635 5:8081917-8081939 ACTCAGGAGGGCTTCAACACAGG - Intergenic
989506400 5:42231082-42231104 ACTCAGCAGGGCTTTCTGACCGG - Intergenic
993404905 5:87499602-87499624 ACTCAGAAAGGCTGTCACACTGG + Intergenic
996881791 5:128305856-128305878 ATCCTGTAGGGCATTCACAGCGG + Exonic
997668185 5:135649027-135649049 ACTCTGCAGGGCTCTCCCAGAGG - Intergenic
999886846 5:155933898-155933920 ATTCTGTGGGTGTTTCACACAGG - Intronic
1006409598 6:33864930-33864952 ACTCAGAAAGGCTGTCACACTGG + Intergenic
1010215694 6:73399287-73399309 ACTATGAAAGGCTTTCACATAGG - Intronic
1017991267 6:159491771-159491793 AATCTGTGGGGTTCTCACACTGG - Intergenic
1023052452 7:36265024-36265046 AATCAGTAGGACTTTCACCCAGG + Intronic
1025854326 7:65264693-65264715 ACTTTGCAGGGCTTTTACACTGG - Intergenic
1035182483 7:157099474-157099496 CCTCTGTGGGGTCTTCACACTGG - Intergenic
1036785161 8:11680885-11680907 CCTCTTTAGGGGTCTCACACAGG - Intronic
1038215956 8:25561941-25561963 ACCCTGAAAGGCTGTCACACTGG - Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1048445216 8:134488170-134488192 ACTCAGTGGGGCCTTCATACAGG + Intronic
1050315104 9:4393140-4393162 ACTCTGTATATCTTTTACACAGG + Intergenic
1050334460 9:4577122-4577144 ACTCTGTATGGTGTTCACAGAGG + Intronic
1052067609 9:24041580-24041602 GCTCTGGAGTGCTTTCACAGTGG + Intergenic
1052684225 9:31733861-31733883 ACTCTGAACGGCCTTGACACAGG + Intergenic
1055471814 9:76619436-76619458 AATCTGTTGTGCTTTCACAGTGG - Intronic
1059920040 9:119150121-119150143 ACACTGTAGGGATTTCACAAGGG - Intergenic
1060735469 9:126064176-126064198 ACTCTGGAGGAATTTCACACAGG - Intergenic
1188783109 X:34309493-34309515 ACTTTGTTTGGCTTTCTCACGGG + Intergenic
1189233356 X:39469385-39469407 ACCCTGCAGGACTTTCACAGTGG + Intergenic
1194096879 X:89652033-89652055 TCTCTTTAGGGATTTCATACAGG + Intergenic
1200766741 Y:7086497-7086519 CCTCTGAAGGGCTTCAACACAGG - Intronic
1200823611 Y:7615347-7615369 TCTCTGTTGGACTTTCTCACAGG - Intergenic
1202046530 Y:20741516-20741538 CCTCTGAAGGGCTTGAACACAGG - Intergenic
1202236446 Y:22715749-22715771 TCTCTGTTGGACTTTCTCACAGG + Intergenic
1202306719 Y:23480421-23480443 TCTCTGTTGGACTTTCTCACAGG - Intergenic
1202564088 Y:26190167-26190189 TCTCTGTTGGACTTTCTCACAGG + Intergenic