ID: 1154246128

View in Genome Browser
Species Human (GRCh38)
Location 18:12701463-12701485
Sequence ACATCTACTAAGTTGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154246128 Original CRISPR ACATCTACTAAGTTGAAAGC TGG (reversed) Intronic
900807169 1:4775088-4775110 ACATCTACTAATTTGAAGCCAGG + Intronic
904475107 1:30759840-30759862 ACAGCTACTAAGTGGGGAGCTGG - Intergenic
904929649 1:34076468-34076490 ACATCTACTAGGTTGAGGCCAGG - Intronic
905946443 1:41905115-41905137 ACATCAACTATGTAGGAAGCAGG - Intronic
906289130 1:44608482-44608504 ACAGCTACAAAGTTCAGAGCAGG - Intronic
908141511 1:61189704-61189726 AGATCTACTGACTTGAAAGCTGG - Intronic
908569107 1:65390087-65390109 GCATCTACTGAGTTGAAAGTAGG - Intronic
910315256 1:85875176-85875198 ATATTTGCTAACTTGAAAGCAGG - Intronic
912309797 1:108608873-108608895 ACATCTGCAAAGCAGAAAGCAGG - Intronic
914952724 1:152131309-152131331 GCATCTACCAAGTTAAAGGCAGG - Intergenic
917685708 1:177413792-177413814 ACAACTACAGAGTTGAAGGCAGG + Intergenic
921659387 1:217781486-217781508 ATAACAACTAACTTGAAAGCAGG + Intronic
921904981 1:220486722-220486744 GCATCTAGTAGGTAGAAAGCAGG - Intergenic
922188079 1:223293877-223293899 ACATCTAGTCAGTTGAAAAGGGG - Intronic
922290159 1:224203209-224203231 AGTTATACTAAGTAGAAAGCGGG - Intergenic
1070201905 10:74215319-74215341 CTTTCTACTAAGTTGAAAGTAGG + Intronic
1072318238 10:94223892-94223914 ACATTTACTAAGTGGAAAATGGG - Intronic
1073141197 10:101249172-101249194 ACATCTCCTAAGCTGGGAGCTGG + Intergenic
1073732120 10:106301335-106301357 TCATTTGCTTAGTTGAAAGCTGG + Intergenic
1073973240 10:109069231-109069253 TCATCTACAAAGCAGAAAGCAGG - Intergenic
1075685187 10:124359714-124359736 ACAAGTTCTAAGTGGAAAGCAGG + Intergenic
1077620192 11:3714977-3714999 ATATATACAAAATTGAAAGCAGG - Intronic
1079366275 11:19813054-19813076 ACCTCTACAAAGTTGAATGAAGG + Intronic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1079692676 11:23439318-23439340 ACTACCACTAAGTTGAAAGTGGG + Intergenic
1081049993 11:38326967-38326989 ACAACTAGTAAGTCGAAGGCCGG - Intergenic
1086474241 11:87153371-87153393 ATATCAACTAATTTGAAAACTGG - Intronic
1087902030 11:103651661-103651683 ACAGCTAGAAAGTTGAAGGCTGG - Intergenic
1093030417 12:14283566-14283588 TCATTTACTAAGTTGGAAACTGG + Intergenic
1094642553 12:32290171-32290193 ACATATAGTAGGTTGAAAGCAGG + Intronic
1095158523 12:38888076-38888098 ATCTCCACTAAGTAGAAAGCTGG + Intronic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1101653938 12:106703294-106703316 CCATCTACAATGTGGAAAGCCGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103116054 12:118333637-118333659 AAATCTATTAAATTGAAAACAGG + Intronic
1104266599 12:127239145-127239167 TCATCTAGTAAGTTGATTGCTGG + Intergenic
1107525411 13:41226227-41226249 ACATTTACTAACTTGCAAACTGG + Intronic
1107626418 13:42290482-42290504 AAATCTACTGGGTTAAAAGCTGG - Intronic
1111933691 13:94537328-94537350 ACATCTAGTAACTTGAAAGATGG + Intergenic
1126921465 15:53530523-53530545 GAAAATACTAAGTTGAAAGCAGG + Intronic
1128236357 15:66070199-66070221 ACATCTCCGAAGATTAAAGCTGG - Intronic
1130619241 15:85444341-85444363 AAATGTACTAAGGTGAAATCTGG - Intronic
1131322943 15:91413457-91413479 ACATCTCCTAAGTTAAGACCAGG + Intergenic
1137668101 16:50263404-50263426 ACATCTTCCAAGGAGAAAGCTGG + Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141149372 16:81553361-81553383 AAAGCAACAAAGTTGAAAGCAGG + Intronic
1149023687 17:51999659-51999681 CCATCATCAAAGTTGAAAGCTGG + Intronic
1151267265 17:72966397-72966419 ACATATACTCAGGTGAAAGATGG + Intronic
1152192005 17:78893990-78894012 ACATAGACTAAGATGAAAGAAGG - Intronic
1153014979 18:575453-575475 TCATATACAGAGTTGAAAGCAGG + Intergenic
1154246128 18:12701463-12701485 ACATCTACTAAGTTGAAAGCTGG - Intronic
1154326403 18:13394005-13394027 ACACCTACTAAATTGCAAGTAGG - Intronic
1159111538 18:64064165-64064187 ACATCATATAAGTTGAAAACTGG - Intergenic
1160112452 18:76046436-76046458 ATATCTAGTGAGTTGAAAGAAGG - Intergenic
1160209911 18:76868896-76868918 CCATCTAATATGTTAAAAGCTGG + Intronic
1160258655 18:77269402-77269424 ATATCTATTAAGTGGAAAGAAGG + Exonic
1165239419 19:34453305-34453327 ATATCTTCTCAGTTCAAAGCAGG + Intronic
926658094 2:15431797-15431819 ACATCTACTAACTGGATAGTTGG + Intronic
929119971 2:38476543-38476565 ACATCTACTCAGCTGTAACCCGG + Intergenic
929981475 2:46684285-46684307 TCTTCTACCAAGTGGAAAGCTGG - Intergenic
931918803 2:66989706-66989728 ACATATTTTAAATTGAAAGCTGG + Intergenic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
938958326 2:136318938-136318960 TCATCTGTTAAGTTGAAACCAGG + Intergenic
939249814 2:139669029-139669051 ACATCTCCCAAGTTGAACCCCGG + Intergenic
939473738 2:142658869-142658891 ACAATTCCTAAGTTGAAAGAGGG - Intergenic
944292937 2:198028487-198028509 CTCTCTGCTAAGTTGAAAGCAGG - Intronic
945706757 2:213244605-213244627 ACATCTACTACCCTTAAAGCAGG + Intergenic
1177326199 21:19592149-19592171 ACATCTCATAAGTTGAAACTTGG + Intergenic
1178136574 21:29634665-29634687 AGAGCTACGGAGTTGAAAGCAGG + Intronic
1178519223 21:33273706-33273728 ACATAAACTTAGTTGATAGCAGG - Intronic
1178754964 21:35340217-35340239 TCATGTACAAAGTAGAAAGCTGG - Intronic
1179363057 21:40730748-40730770 AAATCTACTGATTTGAAATCTGG - Intronic
960977023 3:123185358-123185380 TCATCCAATCAGTTGAAAGCTGG - Intronic
961305238 3:125954728-125954750 ACATCTACTATGTGCTAAGCAGG - Intergenic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
965030733 3:163363623-163363645 TCATCTCCTATGTTGACAGCGGG + Intergenic
966334828 3:178856454-178856476 ACATTTTGTAAGTTGAAAGACGG - Intergenic
973634379 4:52848463-52848485 AAATCACCTAAGTGGAAAGCAGG - Intergenic
974636502 4:64569911-64569933 ACATTTAATAAGTAGAAAACTGG - Intergenic
978251412 4:106635745-106635767 TTATCTACCAAGTTGAATGCTGG + Intergenic
978763634 4:112381836-112381858 ACATCTACTAATGTGAAACAGGG + Intronic
984191925 4:176616059-176616081 ACAGCTACTAAGCTAACAGCTGG - Intergenic
987246914 5:16058480-16058502 ACATATACTACGTTGGATGCTGG + Intergenic
988367178 5:30315503-30315525 ACATTTACTAAGTGGAAACAGGG + Intergenic
990765037 5:59173048-59173070 ACAACTACTAAGAGGAAAGCTGG + Intronic
991050206 5:62264805-62264827 ACCTCTATTAAGTTGAAAATGGG + Intergenic
993117029 5:83731959-83731981 ATATCTTGTAAGTTTAAAGCAGG + Intergenic
993418745 5:87672495-87672517 ACATCTACTAAGTTGAAAGTTGG + Intergenic
995111272 5:108431530-108431552 ACATATTCTAACTTGAAAGTAGG + Intergenic
1000268241 5:159658406-159658428 CCATCTACGAAGCTGAGAGCTGG - Intergenic
1001057041 5:168458290-168458312 ACAGCTGCTAAGTACAAAGCTGG + Intronic
1002426382 5:179178785-179178807 AAATGTACTGAGTTGAAGGCAGG + Intronic
1004370608 6:15049114-15049136 ACACCAACTAAGTGGAAAGTCGG + Intergenic
1004796329 6:19089848-19089870 ACATCCACTAAGCTGTAACCAGG - Intergenic
1005719914 6:28590934-28590956 ACATCAACAAAGTGGAAAGAAGG - Intronic
1009046039 6:58238406-58238428 GCTTGTACTAAGTTGGAAGCAGG + Intergenic
1009221851 6:60992717-60992739 GCTTGTACTAAGTTGGAAGCAGG + Intergenic
1009422623 6:63480550-63480572 ACATCTAGTGAGATGAAAGATGG - Intergenic
1010602662 6:77850093-77850115 GCACCTACAGAGTTGAAAGCAGG + Intronic
1010694294 6:78950790-78950812 AAATCTATGAAATTGAAAGCTGG - Intronic
1010761033 6:79723672-79723694 CCATCTACAAAGTAGGAAGCAGG - Intergenic
1013786704 6:113789408-113789430 CCATCTACGAACCTGAAAGCAGG - Intergenic
1013948500 6:115751432-115751454 ACAGCTATTTAGTTGGAAGCTGG + Intergenic
1016430396 6:143978158-143978180 AAATCAACAAAGTTGAAAACAGG - Intronic
1018155275 6:160979858-160979880 TCATCCACTAATGTGAAAGCAGG + Intergenic
1021312526 7:19111599-19111621 ACATCCACAAACTTGAGAGCGGG + Intronic
1021485146 7:21159319-21159341 ACTTTTACTGAGTTGAAACCAGG + Intergenic
1022692765 7:32673505-32673527 AAATCTAGTATGTGGAAAGCAGG - Intergenic
1022920442 7:35008039-35008061 AAATCTAGTATGTGGAAAGCAGG - Intronic
1023595775 7:41828327-41828349 ACATCCAGTGAGTTGAAAGTAGG + Intergenic
1023659192 7:42455650-42455672 ACAACTACCAAGCTGAAAGATGG + Intergenic
1023888184 7:44375440-44375462 ACCTCTGCTAAGTGGAAGGCAGG - Intergenic
1026793683 7:73351772-73351794 ACAGCTACTAAGTTCAATCCTGG + Intronic
1026929415 7:74215562-74215584 ACGTCTGCTAAGTGGAAAGATGG - Intronic
1028265291 7:88716484-88716506 ACATTCACTAAGTGGAGAGCTGG - Intergenic
1028290218 7:89056399-89056421 AAATCAACCAAGTTGAAAACGGG + Intronic
1031207257 7:118776374-118776396 ACAACTAGTAAGTTGCCAGCTGG + Intergenic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1035081878 7:156222868-156222890 CCATCCACTACGTTGGAAGCTGG - Intergenic
1041534021 8:58905402-58905424 ACATTTTCTAACTTGAAAGGTGG + Intronic
1042937464 8:74074435-74074457 ACATCAACAAAATTAAAAGCTGG - Intergenic
1043878356 8:85512138-85512160 ACATCTACTTTGTTGAAAATTGG - Intergenic
1045184344 8:99821375-99821397 ACATCTCCAAAGTGGAAAGATGG + Exonic
1047564729 8:126031553-126031575 ACATCTACTAAGCAGAGACCAGG - Intergenic
1059843824 9:118248665-118248687 GCAACTACCAAGTGGAAAGCAGG - Intergenic
1187026415 X:15439947-15439969 ACACCAACCAAGTTAAAAGCTGG + Intronic
1187900522 X:24023887-24023909 ACTTCTACTAATTTGAAAATTGG - Intronic
1192741761 X:73900220-73900242 ACATGTACTCAGTTATAAGCAGG + Intergenic
1193225108 X:78973219-78973241 TAATCTACAAAGTTGAAAGTGGG - Intergenic
1193746387 X:85287288-85287310 AAATCAATTAAATTGAAAGCTGG + Intronic
1194635409 X:96340703-96340725 AAATATACAAAGTGGAAAGCTGG - Intergenic
1194964753 X:100274927-100274949 ATATGTAGTAATTTGAAAGCTGG - Intergenic
1196523764 X:116707333-116707355 GCATCTACTGATTTGAATGCAGG - Intergenic
1197598620 X:128499126-128499148 AAATCAACTAAGTTTAAAACAGG - Intergenic
1198923741 X:141762741-141762763 ACATTTACAAATTTGAAAGGTGG + Intergenic
1200957855 Y:8969945-8969967 ACACCAACTGAGTGGAAAGCTGG + Intergenic