ID: 1154250945

View in Genome Browser
Species Human (GRCh38)
Location 18:12744539-12744561
Sequence TTAAAAACCATGTCATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154250945_1154250948 -1 Left 1154250945 18:12744539-12744561 CCTTGAGATGACATGGTTTTTAA No data
Right 1154250948 18:12744561-12744583 AAGGATATTGTATATTCGTAGGG No data
1154250945_1154250947 -2 Left 1154250945 18:12744539-12744561 CCTTGAGATGACATGGTTTTTAA No data
Right 1154250947 18:12744560-12744582 AAAGGATATTGTATATTCGTAGG No data
1154250945_1154250949 19 Left 1154250945 18:12744539-12744561 CCTTGAGATGACATGGTTTTTAA No data
Right 1154250949 18:12744581-12744603 GGGAAAAAAATCATTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154250945 Original CRISPR TTAAAAACCATGTCATCTCA AGG (reversed) Intergenic
No off target data available for this crispr