ID: 1154252426

View in Genome Browser
Species Human (GRCh38)
Location 18:12755726-12755748
Sequence GAGGAACGGTGCCATGTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154252418_1154252426 1 Left 1154252418 18:12755702-12755724 CCAGGTAGCTGGCTGGTCACCCC 0: 3
1: 93
2: 215
3: 224
4: 264
Right 1154252426 18:12755726-12755748 GAGGAACGGTGCCATGTCGAGGG No data
1154252412_1154252426 21 Left 1154252412 18:12755682-12755704 CCAATATAATCAACCTGCCACCA 0: 156
1: 212
2: 191
3: 173
4: 273
Right 1154252426 18:12755726-12755748 GAGGAACGGTGCCATGTCGAGGG No data
1154252417_1154252426 4 Left 1154252417 18:12755699-12755721 CCACCAGGTAGCTGGCTGGTCAC 0: 4
1: 173
2: 232
3: 204
4: 306
Right 1154252426 18:12755726-12755748 GAGGAACGGTGCCATGTCGAGGG No data
1154252415_1154252426 8 Left 1154252415 18:12755695-12755717 CCTGCCACCAGGTAGCTGGCTGG 0: 3
1: 159
2: 226
3: 226
4: 377
Right 1154252426 18:12755726-12755748 GAGGAACGGTGCCATGTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154252426 Original CRISPR GAGGAACGGTGCCATGTCGA GGG Intergenic
No off target data available for this crispr