ID: 1154252669

View in Genome Browser
Species Human (GRCh38)
Location 18:12757261-12757283
Sequence CTTGGCCTGTTACTAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154252669_1154252671 -6 Left 1154252669 18:12757261-12757283 CCAAAGCCTAGTAACAGGCCAAG No data
Right 1154252671 18:12757278-12757300 GCCAAGAGCTGTCTCTCAAAAGG 0: 173
1: 182
2: 165
3: 95
4: 236
1154252669_1154252673 18 Left 1154252669 18:12757261-12757283 CCAAAGCCTAGTAACAGGCCAAG No data
Right 1154252673 18:12757302-12757324 GAGTAGTTACCTGCAGAAGATGG No data
1154252669_1154252674 22 Left 1154252669 18:12757261-12757283 CCAAAGCCTAGTAACAGGCCAAG No data
Right 1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG No data
1154252669_1154252675 23 Left 1154252669 18:12757261-12757283 CCAAAGCCTAGTAACAGGCCAAG No data
Right 1154252675 18:12757307-12757329 GTTACCTGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154252669 Original CRISPR CTTGGCCTGTTACTAGGCTT TGG (reversed) Intergenic
No off target data available for this crispr