ID: 1154252674

View in Genome Browser
Species Human (GRCh38)
Location 18:12757306-12757328
Sequence AGTTACCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154252672_1154252674 4 Left 1154252672 18:12757279-12757301 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG No data
1154252668_1154252674 25 Left 1154252668 18:12757258-12757280 CCACCAAAGCCTAGTAACAGGCC No data
Right 1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG No data
1154252670_1154252674 16 Left 1154252670 18:12757267-12757289 CCTAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG No data
1154252669_1154252674 22 Left 1154252669 18:12757261-12757283 CCAAAGCCTAGTAACAGGCCAAG No data
Right 1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154252674 Original CRISPR AGTTACCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr