ID: 1154254155

View in Genome Browser
Species Human (GRCh38)
Location 18:12768204-12768226
Sequence TAGAACAAGGGGTGGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154254155_1154254164 16 Left 1154254155 18:12768204-12768226 CCTGACCACCACCCCTTGTTCTA No data
Right 1154254164 18:12768243-12768265 CAAGTTCCAGCAAGTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154254155 Original CRISPR TAGAACAAGGGGTGGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr