ID: 1154254495

View in Genome Browser
Species Human (GRCh38)
Location 18:12770701-12770723
Sequence ATGGCCACGTGGTAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154254495_1154254501 10 Left 1154254495 18:12770701-12770723 CCTTTCTCCTACCACGTGGCCAT No data
Right 1154254501 18:12770734-12770756 TCCCATGCCTGTAGCCTTGTGGG No data
1154254495_1154254503 11 Left 1154254495 18:12770701-12770723 CCTTTCTCCTACCACGTGGCCAT No data
Right 1154254503 18:12770735-12770757 CCCATGCCTGTAGCCTTGTGGGG No data
1154254495_1154254500 9 Left 1154254495 18:12770701-12770723 CCTTTCTCCTACCACGTGGCCAT No data
Right 1154254500 18:12770733-12770755 CTCCCATGCCTGTAGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154254495 Original CRISPR ATGGCCACGTGGTAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr