ID: 1154257725

View in Genome Browser
Species Human (GRCh38)
Location 18:12798616-12798638
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1095
Summary {0: 2, 1: 79, 2: 130, 3: 207, 4: 677}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154257725_1154257726 1 Left 1154257725 18:12798616-12798638 CCATGCTGTATATGTACATTTTC 0: 2
1: 79
2: 130
3: 207
4: 677
Right 1154257726 18:12798640-12798662 TTATGCAGTCTATCATTGATAGG 0: 90
1: 4099
2: 5843
3: 4678
4: 3704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154257725 Original CRISPR GAAAATGTACATATACAGCA TGG (reversed) Intronic
902939745 1:19792171-19792193 GAAAATGGACTAATACACCAAGG + Intronic
903920867 1:26799733-26799755 GAAAATGTACACACAGATCAGGG + Intergenic
904132210 1:28283282-28283304 GAAAATGAACAGATACCTCAAGG - Intergenic
904218476 1:28943991-28944013 GAAAATCTACATATACACATTGG + Intronic
904944161 1:34187139-34187161 GAAAATGAAAATATAGAGCCTGG - Intronic
905456192 1:38089627-38089649 AGAAATGTACATACACAGCCAGG - Intergenic
906246785 1:44281763-44281785 GAATATGTGCATATACATGAAGG + Intronic
906785497 1:48611953-48611975 GAAAAGGAACATAAACAGCTAGG + Intronic
906882985 1:49613012-49613034 GAAAATGTACATATACATCATGG + Intronic
906954842 1:50365194-50365216 GATAAGGCACATATACACCATGG + Intergenic
907203727 1:52750808-52750830 GTAAATGTACAGAGACAGAAAGG - Intronic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
907377829 1:54058603-54058625 GAATGCGTACATATAAAGCAGGG - Intronic
907891198 1:58637974-58637996 GAAAATGTATATATACATGATGG - Intergenic
908114930 1:60931297-60931319 GATCATTTACACATACAGCAAGG + Intronic
908270572 1:62417938-62417960 GCAGATGTACATATACATGAAGG + Intergenic
908492089 1:64655296-64655318 GAAAATGTGTATATACAGGCAGG + Intronic
908861074 1:68490461-68490483 AAATGTGTACATATACACCATGG - Intronic
908874132 1:68650437-68650459 GAAAATGCAAATAAACATCATGG - Intergenic
909053833 1:70799671-70799693 GAAAATGAACATATACACCATGG + Intergenic
909194227 1:72595543-72595565 AAAAATGTACACATACATAATGG + Intergenic
909200406 1:72684929-72684951 GGAACAGTACATATTCAGCAAGG + Intergenic
909520124 1:76558372-76558394 GAAAATGTACATATACACCATGG + Intronic
909598033 1:77428960-77428982 GAAAAGGCACATATACACCGTGG - Intronic
909617046 1:77622510-77622532 GAAAAAGAACATATTCACCATGG + Intronic
909758552 1:79259618-79259640 GACACTGAACATTTACAGCAGGG - Intergenic
909897009 1:81083908-81083930 GAAAATGTAAATATATACCATGG - Intergenic
910102786 1:83596629-83596651 GATAAGGTACATATTCAGGAAGG - Intergenic
910139729 1:84013860-84013882 GAAAATGTACATATACGCCATGG + Intergenic
910148230 1:84108106-84108128 GAAAATGTACATATACACCATGG + Intronic
910896768 1:92078097-92078119 TAAAAAGTACATAAACAGAAAGG - Intergenic
911136111 1:94442826-94442848 AAAAATGTACATATATACCATGG - Intronic
911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG + Exonic
911468817 1:98290308-98290330 GAAAATATACATTTATACCATGG - Intergenic
911573575 1:99547418-99547440 GAAAATCTATAGATACAGAAAGG - Intergenic
911667823 1:100574083-100574105 GAAAATGTACATATATGCCACGG + Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912610458 1:111037380-111037402 GAAAATGTACATATGCATAATGG + Intergenic
913472229 1:119200613-119200635 AAAAATGGACATATAAACCAGGG + Intergenic
913567647 1:120088783-120088805 GAAAATGTACATACATACCATGG - Intergenic
913708415 1:121452699-121452721 AAATGTGTACATATACACCATGG - Intergenic
914288393 1:146249491-146249513 GAAAATGTACATACATACCATGG - Intergenic
914549429 1:148700237-148700259 GAAAATGTACATACATACCATGG - Intergenic
914617252 1:149371481-149371503 GAAAATGTACATACATACCATGG + Intergenic
914693729 1:150055666-150055688 GAAAATGTACGTATACACCATGG + Intergenic
914697942 1:150102653-150102675 GAAAATGTACATATACACCATGG + Intronic
915049610 1:153054508-153054530 GATATGGTACATATACACCATGG + Intergenic
915773550 1:158456270-158456292 AAAAATGTATATATACACCATGG + Intergenic
915925323 1:160013697-160013719 GAAAATGTATATATACACAATGG + Intergenic
916011302 1:160708387-160708409 GAAAATGTATACCGACAGCAGGG + Intronic
916370122 1:164082799-164082821 GAATATGTACATATAAAACAAGG - Intergenic
916639993 1:166717486-166717508 CAAAATGTACAAACAAAGCAAGG - Intergenic
916897402 1:169179588-169179610 GAAAATGTACATATACACCATGG + Intronic
916968592 1:169982162-169982184 CAAAATGTAAATACACAGAAAGG + Intronic
917302516 1:173591238-173591260 GAAAATGTACATATTTGCCATGG - Intronic
917604045 1:176607567-176607589 GAACATGTATATATACACGATGG - Intronic
918056756 1:181028201-181028223 GAATATGTACATGTATATCAGGG - Intergenic
918440846 1:184565893-184565915 GAAAATTTACATACACAGATTGG - Intronic
918802653 1:188991819-188991841 GAAAATTTACTTATACTGCAAGG + Intergenic
918977583 1:191510689-191510711 GAAAATGTTAAGATACATCAAGG - Intergenic
919194159 1:194262697-194262719 GAAAATGTACATATACAACATGG + Intergenic
919260060 1:195180756-195180778 GGAAATGTACATATACACCGTGG - Intergenic
919962135 1:202482103-202482125 GAAAATGTGTATATCCAGAATGG - Intronic
920809868 1:209273602-209273624 AATATGGTACATATACAGCATGG - Intergenic
921095161 1:211880128-211880150 GAAAATGTGCGTATACATCTTGG - Intergenic
921295653 1:213699419-213699441 GAAAATGTACTTATACACAACGG - Intergenic
921352736 1:214253725-214253747 GAAAATATACATATATATGATGG - Intergenic
921399378 1:214703748-214703770 GAAAATGTACGTACACAAGATGG - Intergenic
921457248 1:215386833-215386855 GAAAATATACATATACACAATGG + Intergenic
921634906 1:217480766-217480788 GAAAATGTACATATACATAATGG + Intronic
921760483 1:218908177-218908199 TAAAATATACATATACACAATGG - Intergenic
922138198 1:222853521-222853543 GAAAATGTATATATACACCACGG + Intergenic
922688755 1:227669980-227670002 GAAAACGTACATTTACACCATGG + Intronic
922713119 1:227848145-227848167 GAAAATATACATATATATCATGG - Intergenic
923085369 1:230699158-230699180 GAAAATGTAGATATACACCATGG - Intergenic
923177530 1:231481626-231481648 GAAAATGTACACATACACTGTGG - Intergenic
923212601 1:231818232-231818254 GCTAATGTACATTCACAGCATGG - Intronic
924269375 1:242316972-242316994 GAAAATGTGCATATACACCATGG - Intronic
924331457 1:242944823-242944845 GAAAAGGTCCATCTACATCAGGG + Intergenic
924522601 1:244818069-244818091 CAATATGTTCATACACAGCAAGG - Intergenic
924702291 1:246466306-246466328 GAAAATGTACCTATACACCATGG + Intronic
924769836 1:247069624-247069646 GAAAATGTACATACACACAGTGG + Intronic
924848565 1:247799512-247799534 GAATATGTATATATACATCATGG - Intergenic
924919842 1:248617150-248617172 AATACTGTACATATACATCATGG + Intergenic
1063450977 10:6149941-6149963 GAAAATGTACATATACAACATGG - Intronic
1063712822 10:8496055-8496077 GAAAATAAAAATATACAGCCGGG - Intergenic
1063748637 10:8916633-8916655 GAAAATGTAAATATACACCATGG + Intergenic
1063819305 10:9816481-9816503 GAAAATTTACATATACACCATGG - Intergenic
1063856136 10:10256226-10256248 TAAAATGCACACATAAAGCATGG - Intergenic
1063860075 10:10297069-10297091 AAAATGGTACATATACACCATGG - Intergenic
1063871806 10:10425207-10425229 GAAAATGTAGATACATAGAATGG + Intergenic
1064572339 10:16707105-16707127 GAAAATGTATATATACATAATGG - Intronic
1064791569 10:18962412-18962434 GAAAATGGACTAATACAGGAGGG - Intergenic
1064798291 10:19039119-19039141 GAAAATGTACATATACACCATGG + Intergenic
1064930886 10:20625283-20625305 GAAAATGGACTAATACAGAAAGG - Intergenic
1065146433 10:22772832-22772854 AAAAATGTACATATACACCATGG - Intergenic
1065554223 10:26898759-26898781 GCAAAGGTACATATACACCATGG - Intergenic
1065598737 10:27346425-27346447 GCAAAGGTACATATACACCATGG + Intergenic
1065640073 10:27772619-27772641 GAAAATGTATATATACACCATGG - Intergenic
1065647596 10:27852212-27852234 GAAAATCTGCATTTACAGAAAGG + Intronic
1065653039 10:27914111-27914133 GAAAATGTACATACAAACCATGG + Intronic
1065943996 10:30590588-30590610 GAAAATGTATATATAAACCATGG + Intergenic
1066173647 10:32879912-32879934 GAAAATGTACATATACACCATGG - Intronic
1066174521 10:32890170-32890192 AAAAATGTATATGGACAGCAAGG + Intergenic
1066236109 10:33486254-33486276 AAAAATGAACAAATACAGGAAGG - Intergenic
1066281473 10:33922310-33922332 GAAAATGGACTAATACAGAACGG + Intergenic
1066547331 10:36514399-36514421 GGAAATGTACATAAACTTCACGG - Intergenic
1067016756 10:42762311-42762333 GAAAATGTGCATATATACAATGG - Intergenic
1067206966 10:44226304-44226326 AATATTGTACATATACACCATGG - Intergenic
1067319364 10:45203141-45203163 GCAAAGGTACATATACACCATGG + Intergenic
1067807114 10:49400392-49400414 GAAAATATATATACACAACAAGG + Intergenic
1067929813 10:50549324-50549346 GAAAATGTACATATACACCATGG + Intronic
1068134423 10:52937537-52937559 GAAAAATTTCATAAACAGCAAGG + Intergenic
1068264423 10:54627638-54627660 GAAAATGGACTAATACAGCCAGG + Intronic
1068502242 10:57854981-57855003 AATATTGTACATATACACCATGG - Intergenic
1068642030 10:59419983-59420005 GAAAATGTACTTATACATAATGG + Intergenic
1068924899 10:62526261-62526283 GAAAATGGACTAATACAGAAGGG - Intronic
1069341674 10:67417077-67417099 AAAATAGTACATATACACCATGG + Intronic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1070452330 10:76573602-76573624 GAAAATGTTCAAATAAATCATGG + Intergenic
1070579296 10:77707618-77707640 GAAAATGTACAGATACACAATGG + Intergenic
1070772979 10:79093211-79093233 GATAATGCACATAAACTGCATGG - Intronic
1071022650 10:81076787-81076809 GGAAATGTACATATACACCACGG - Intergenic
1071195151 10:83150265-83150287 AACAATGTAAATATACACCATGG + Intergenic
1071605819 10:86987849-86987871 GAAAATGTGCATATATACAATGG - Intergenic
1071667356 10:87572629-87572651 GAAAATGTATATATACACAAAGG + Intergenic
1071949958 10:90692267-90692289 GAAAATGTATATACACACAATGG - Intergenic
1073009413 10:100347872-100347894 GAAACTGTACAGATACATTAGGG - Intronic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1073669500 10:105571891-105571913 GAAAATGTACGTATATAACATGG + Intergenic
1073828093 10:107349051-107349073 GAAAAGGCACATATATACCATGG - Intergenic
1074009578 10:109463644-109463666 CCAAATGTACATAGCCAGCAAGG + Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1075188079 10:120281375-120281397 GGAAATGCACATATACACCATGG + Intergenic
1075278444 10:121117238-121117260 ATAAATGTACATATATACCATGG + Intergenic
1075500503 10:122969439-122969461 GAAAATGTACATATACACCATGG + Intronic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1075860352 10:125669957-125669979 GAAAATGTACATGTACACCACGG - Intronic
1077180809 11:1214283-1214305 GAAAATGGACTAATACAGAACGG - Intergenic
1077770380 11:5211737-5211759 GAACATGTACATATACACCATGG - Intergenic
1077945326 11:6891306-6891328 ACAAAAGTACATATACACCATGG - Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078113271 11:8418448-8418470 GAAAATGTACATATACACCATGG - Intronic
1078121126 11:8509867-8509889 GAAAATGTATGTACACAGCATGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078477408 11:11642959-11642981 GAAAATGGACTTAGACAGCAAGG - Intergenic
1078556833 11:12334813-12334835 GAAAATGTACATATACACCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1078645625 11:13139280-13139302 GAAAATGTACATATACATCATGG - Intergenic
1079437325 11:20470593-20470615 GTACATATACATATACACCATGG - Intronic
1079945675 11:26737938-26737960 AGAAATGTACATGTACACCAAGG + Intergenic
1080351627 11:31391880-31391902 AAAAATGTATATATACACAACGG + Intronic
1080598340 11:33796903-33796925 GAAAATGTATGTATACATAACGG + Intergenic
1080996419 11:37607913-37607935 GAAAATGTACCCATGCATCATGG + Intergenic
1081183941 11:40019384-40019406 TAAAATGTACATATTCCTCATGG + Intergenic
1081240269 11:40697148-40697170 AAAAATGTATATATGCAGTATGG - Intronic
1081378093 11:42383124-42383146 GAAAAGCAACATATAAAGCAAGG + Intergenic
1082199355 11:49344996-49345018 GAAAATGTATACATACAACATGG - Intergenic
1082230957 11:49765578-49765600 AAAATGGTACATATACACCATGG - Intergenic
1082306920 11:50590023-50590045 CAAAATGTACATTCACAGAATGG - Intergenic
1082627126 11:55499709-55499731 GGAAATGTATATATACAACATGG - Intergenic
1082702619 11:56451724-56451746 GAAAATGTACAGATACGCCATGG - Intergenic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1083060652 11:59867313-59867335 GCAAATGTACATATACACAATGG + Intergenic
1084796527 11:71509685-71509707 GAAAATGTGTATATACACAATGG + Intronic
1085142546 11:74160369-74160391 AAAAATGTATATATACACGATGG + Intronic
1085594697 11:77798618-77798640 AAAAAGGCACATATACACCATGG + Intronic
1085682486 11:78590668-78590690 GAAAATGTACATGCACACAATGG + Intergenic
1085977719 11:81679867-81679889 GAAAATCTATATATACGCCATGG + Intergenic
1086124670 11:83338205-83338227 AATATTGTACATATACACCATGG + Intergenic
1086534557 11:87829318-87829340 GAAAATGAACTGATACAACAGGG - Intergenic
1086679158 11:89647487-89647509 GATTATGTACATATATAACATGG - Intergenic
1086929679 11:92679158-92679180 GAAAATGTATATATACACAATGG - Intronic
1087351523 11:97039726-97039748 GACATTGTATATATACACCATGG + Intergenic
1087372076 11:97297334-97297356 GAATATATAGTTATACAGCATGG - Intergenic
1087512797 11:99119498-99119520 GAAAATCTACATATACATCATGG - Intronic
1087720723 11:101662495-101662517 GAAAATGTACATATATACCATGG - Intronic
1088025156 11:105170878-105170900 AAAAATGTACATATACACCATGG - Intergenic
1088112901 11:106282359-106282381 CAAAATTCAAATATACAGCAGGG + Intergenic
1088273838 11:108063410-108063432 GAAAATGTACATAAACACAATGG - Intronic
1088420385 11:109638567-109638589 GAAAATGTACATACACACAATGG - Intergenic
1088497999 11:110451716-110451738 GAAAATGTACATATACACCATGG + Intronic
1088830885 11:113535903-113535925 GATAAAGAACATATACACCATGG + Intergenic
1089506939 11:118969655-118969677 GAAGGGGTACATATACAGCACGG + Intergenic
1089955271 11:122564890-122564912 AAAGTTGTACATATACAACATGG + Intergenic
1090275337 11:125414801-125414823 GAAAATGTATATAAAGAGCCAGG + Intronic
1090630468 11:128643060-128643082 GAAAATGTATATATACACCATGG + Intergenic
1091864978 12:3825615-3825637 AAAAATGTAAATATACAAGAAGG + Intronic
1092151293 12:6250747-6250769 GAAAATTTACAGGTCCAGCAAGG - Intergenic
1092326807 12:7541259-7541281 GAAAATGTACATATTTAGTTAGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1092590053 12:9945030-9945052 TAAAATATACATATACGGCCGGG + Intergenic
1092746285 12:11675477-11675499 AGAAATGTTCATTTACAGCAAGG + Intronic
1092795268 12:12104502-12104524 CAAAATGGACTAATACAGCAGGG + Intronic
1093097765 12:14991542-14991564 GAAAATGTACATATACACCATGG + Intergenic
1093218514 12:16390669-16390691 AAATGTGTACATATACACCATGG - Intronic
1093419466 12:18958209-18958231 GAAAATGTACACATACACAATGG - Intergenic
1093422538 12:18991598-18991620 GAAAATGTTGAAATATAGCAAGG - Intergenic
1093947367 12:25124980-25125002 GAAAATGTACATACCCACCATGG - Intronic
1093984987 12:25520563-25520585 GAAAATGTAGCTATACACAATGG - Intronic
1094191128 12:27699627-27699649 GAAAAAGTACATCTACAGGGTGG - Intergenic
1094331268 12:29296637-29296659 GAAAATGTAAATAAACTGGAGGG - Intronic
1094367959 12:29704083-29704105 GAAAATGTACAAATACACTTAGG + Intronic
1094790738 12:33911772-33911794 AAATATGTACATATACTCCATGG - Intergenic
1094860179 12:34456191-34456213 CAAAATGTCCATATGCAGAATGG + Intergenic
1095130085 12:38530731-38530753 GAAAATGTACATTTACACCATGG - Intergenic
1095174554 12:39076318-39076340 TAAAATATACAAATACAGCTGGG - Intergenic
1095195597 12:39312152-39312174 GAAAATGTACATACACACAATGG + Intronic
1095258978 12:40076515-40076537 GAAAATGTACATATACACCATGG - Intronic
1095391048 12:41707061-41707083 GAAAATGTACATATACACCATGG - Intergenic
1095590226 12:43894753-43894775 GAAAATGTACATACACACCATGG - Intronic
1095606182 12:44070544-44070566 GAAAATGTACATGAAGAGCCTGG - Intronic
1095989575 12:48025462-48025484 GAAACTTTACATTTGCAGCATGG + Intergenic
1096338117 12:50773127-50773149 GAACATGTACATATATATCATGG - Intronic
1097367847 12:58739845-58739867 GAAAATGTACATATACACCATGG - Intronic
1097375335 12:58836407-58836429 GAAAATGTACATATACACCATGG - Intergenic
1097552157 12:61087698-61087720 GAAAATATACATGTACACGATGG - Intergenic
1097600682 12:61688691-61688713 AAAAATGTACATATACACCATGG - Intergenic
1097619094 12:61918517-61918539 GAAAATGTACACATACACAATGG - Intronic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1097955656 12:65483140-65483162 GAAAATGGACTAATACAGCCTGG + Intronic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1098430363 12:70412719-70412741 GAAAATGTGCATATAAAGATGGG + Intronic
1098439263 12:70500756-70500778 GTACATATACATATACACCATGG + Intergenic
1098481737 12:70969681-70969703 GAAAATGTATATATACACCAAGG - Intergenic
1098787018 12:74772508-74772530 GAAAATGTATATATACAAAGTGG - Intergenic
1098938915 12:76512332-76512354 GAAAATGTACATATACACCATGG - Intronic
1099092955 12:78337060-78337082 GGAAATGTACATATACACAATGG + Intergenic
1099125920 12:78757882-78757904 GGAAATGTTCAAATACACCATGG + Intergenic
1099241332 12:80142849-80142871 GAAGATGTAGAGATACAGCAGGG + Intergenic
1099331407 12:81293920-81293942 TAAAATGTATATACACACCATGG + Intronic
1099355003 12:81622946-81622968 AAGAATATACACATACAGCAAGG + Intronic
1099923149 12:88984021-88984043 GAAAATTTCCATATAAAGAAGGG - Intergenic
1100188663 12:92165794-92165816 AACAATGTACATACACCGCATGG - Intergenic
1100454531 12:94739588-94739610 GAAAATGTGCATATACACCATGG - Intergenic
1100869796 12:98897844-98897866 GAAAATGTAAATATACACCATGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1101548911 12:105743271-105743293 GCAAATGGACATAGACATCAAGG - Intergenic
1102814563 12:115854038-115854060 AAAAATGTACATATACACTATGG - Intergenic
1102815092 12:115858997-115859019 GAAACTGGACATGTACAGAAGGG + Intergenic
1103866877 12:124059661-124059683 GAAAATGTACATATACACCATGG - Intronic
1104262353 12:127196101-127196123 GAAAATGTACATATACATCATGG + Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104489509 12:129181829-129181851 GAAAATGGACAAATAAAGGATGG - Intronic
1104505775 12:129330817-129330839 GAAAATAGACAAATACACCAAGG + Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104781871 12:131426960-131426982 GACAATGTACACAAACAACATGG + Intergenic
1105312877 13:19228986-19229008 TAAAATTTACATTTATAGCAAGG - Intergenic
1105364638 13:19753643-19753665 TAAAATTTACATTTATAGCAAGG - Intronic
1105380967 13:19886999-19887021 GAAAATGTTAATTTACACCAGGG - Intergenic
1105459958 13:20575316-20575338 GAAAATGTACATATATACAATGG - Intronic
1105976222 13:25475379-25475401 GAAAATGTACATATACACTATGG - Intronic
1105982090 13:25527812-25527834 GAAAATGTTCATATATAGCTGGG + Intronic
1106012549 13:25838603-25838625 CAAAATGAACATTTAAAGCAGGG + Intronic
1106048465 13:26167828-26167850 GAAAATGTACATATACACCATGG + Intronic
1106315064 13:28586130-28586152 GAAAATGTAGATCTCCAGCTTGG + Intergenic
1106678832 13:31989080-31989102 GACAATGTATATATACACAATGG - Intergenic
1106755098 13:32814559-32814581 AATGAAGTACATATACAGCAGGG - Intergenic
1107322749 13:39206675-39206697 GCACATATACATATACACCATGG - Intergenic
1107336298 13:39359443-39359465 GAAAATATACAAATACCCCATGG + Intronic
1107563092 13:41575044-41575066 GAAAATGTATATATACACCATGG + Intronic
1107644982 13:42484709-42484731 GAAGGTGTATATTTACAGCAGGG + Intergenic
1108127011 13:47255630-47255652 GAAAATGTAAATATAAAATAGGG - Intergenic
1108262941 13:48676499-48676521 GATATTGTACATATAGAGTAGGG + Intronic
1108263879 13:48685020-48685042 GAGAATGGACTAATACAGCAGGG - Intronic
1108544523 13:51479444-51479466 CAAGATGTAAATATACAGCTAGG - Intergenic
1108545957 13:51493901-51493923 TAAAAAATACATATATAGCATGG - Intergenic
1108595822 13:51948249-51948271 CAAAAAGTACAAATACAGAATGG - Intronic
1108650018 13:52468738-52468760 GAAAATGTACATATACACCATGG - Intronic
1108729402 13:53218049-53218071 TAAAATGTACCTATAGATCAAGG + Intergenic
1108929468 13:55798516-55798538 AATATGGTACATATACAGCATGG - Intergenic
1108997301 13:56749844-56749866 GAAAATGAACACATTAAGCAAGG - Intergenic
1109146422 13:58785249-58785271 AAAATAGTACATATACACCATGG - Intergenic
1109167582 13:59055297-59055319 GAAAATGTACATATACACCATGG + Intergenic
1109588702 13:64446444-64446466 GAAAATGGACTAATACAACAGGG - Intergenic
1109801594 13:67386011-67386033 GAAAATGTACATATTCACCATGG - Intergenic
1109898668 13:68731959-68731981 GAAAATGTACACGTACACCATGG + Intergenic
1109943444 13:69401708-69401730 AAAAATATAAATATGCAGCAAGG + Intergenic
1110007391 13:70290110-70290132 GAAAATGTACATAAACATCATGG + Intergenic
1110128252 13:71975437-71975459 GAAAATGTACATACACACAATGG - Intergenic
1110442698 13:75542964-75542986 GAAAATGTACATATACACCATGG + Intronic
1110556558 13:76866246-76866268 GAAAATGTGTATATACACAATGG - Intergenic
1110642812 13:77845571-77845593 AACATTGTACACATACAGCATGG + Intergenic
1110694370 13:78471083-78471105 GAAAATATAAATAAAAAGCAAGG + Intergenic
1111045669 13:82810834-82810856 GGAAATGTATATATACACCATGG + Intergenic
1111272488 13:85904729-85904751 GAAAATGTACACATACACTGTGG + Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1111364770 13:87228127-87228149 GAAAATGTACCTATATACAATGG - Intergenic
1111371662 13:87327301-87327323 GAAAATGTACTTACAGACCATGG + Intergenic
1111702248 13:91705416-91705438 GAAAATGTCAATAGAAAGCATGG + Intronic
1111777116 13:92678421-92678443 GAGAATGTTCTTATACAGTAAGG - Intronic
1112120514 13:96405150-96405172 GAAAACGAACTAATACAGCAGGG + Intronic
1112302621 13:98243877-98243899 GAAATTCCACATGTACAGCAGGG - Intronic
1112380579 13:98885305-98885327 AAAAATGTACATATGCAGGCTGG + Intronic
1112432949 13:99368600-99368622 GAAAATAAATATATAAAGCAGGG + Intronic
1112556660 13:100474774-100474796 CAAAATGGACATATACGGCCAGG - Intronic
1112718709 13:102217016-102217038 GAAAATGTACATCTACACAGTGG - Intronic
1112824465 13:103375968-103375990 GAAAATGTACATATACGGCATGG + Intergenic
1112863926 13:103870462-103870484 GAAAGTGTACATATACGACATGG - Intergenic
1112984762 13:105434665-105434687 GAAAATGTTCATCTGAAGCAGGG - Intergenic
1113208983 13:107952644-107952666 GAAAATGTACGTACACACAACGG + Intergenic
1113344213 13:109458248-109458270 GAAAATGTATATATACACTATGG - Intergenic
1113452442 13:110420839-110420861 TTAAATGGACATTTACAGCATGG - Intronic
1114582108 14:23771478-23771500 GATATGGTACATATACACCATGG - Intergenic
1114876336 14:26724275-26724297 AAATGTGTACATATACACCATGG - Intergenic
1115046094 14:28996032-28996054 GAAAATTTACATAGACATAAAGG - Intergenic
1115254369 14:31383391-31383413 GTAAATGTACTTATATGGCAGGG + Intronic
1115912303 14:38269916-38269938 AAAAATGTACATATACACCATGG + Intergenic
1116080604 14:40166053-40166075 GAAAATGTACATATACGCAATGG + Intergenic
1116089589 14:40287958-40287980 GAAAATGTATGTATACACCATGG - Intergenic
1116224104 14:42126093-42126115 GAAAATGTACATATGCACTATGG + Intergenic
1116224108 14:42126178-42126200 GAAAATGTACATATGCACTATGG + Intergenic
1116300273 14:43171306-43171328 GAAAATGTAGAAATACATGATGG + Intergenic
1116726510 14:48566972-48566994 CAAAATGCACACATAAAGCAAGG + Intergenic
1117342136 14:54801649-54801671 AAAATAGTACATATACACCATGG + Intergenic
1117482581 14:56162473-56162495 GAAAATGTACATATACGCAATGG - Intronic
1117686007 14:58253929-58253951 GAAAATGTATATATACACAATGG - Intronic
1117836008 14:59806825-59806847 GATGAAGTACATATACACCATGG - Intronic
1118146937 14:63147899-63147921 GTAAATGTACATATACACCATGG - Intergenic
1118336929 14:64861459-64861481 GATACTGTGCATCTACAGCAGGG + Intronic
1118544050 14:66864898-66864920 GAAAATGTACATCTACACAATGG + Intronic
1118965430 14:70579047-70579069 AAAAATGTACCTATACACCATGG - Intergenic
1119219444 14:72894021-72894043 AAAAATGTACATATTCCGCGTGG - Intronic
1119580002 14:75769881-75769903 GAAAATGTACATTTATGGCCAGG + Intronic
1119815262 14:77560641-77560663 ATATATGTACATATACACCATGG + Intronic
1119906469 14:78307743-78307765 TAAAATTTACATGTAAAGCAAGG + Intronic
1120075253 14:80149404-80149426 GAAAATGGATATATACACAATGG - Intergenic
1120137060 14:80882695-80882717 GAAAATGTACTTATACACAACGG + Intronic
1120277928 14:82401017-82401039 GACATGGTACATATACACCATGG + Intergenic
1120570822 14:86114821-86114843 AAAATAGTACATATACACCATGG - Intergenic
1120597556 14:86460272-86460294 GACAACATACATATACAGCTGGG + Intergenic
1120619193 14:86742189-86742211 GAAAATGTTCATATACACAGTGG - Intergenic
1120625115 14:86815862-86815884 GAAAATGTACATATATACCATGG + Intergenic
1122002907 14:98678421-98678443 GAAAATGTATATACACACAATGG - Intergenic
1122012640 14:98764066-98764088 CAAAATGTTCTTATAGAGCAAGG + Intergenic
1122386569 14:101352314-101352336 GAAAATGTACCAAGAAAGCATGG + Intergenic
1122595994 14:102892708-102892730 TAAAATGTAAATATACTGCAAGG + Intronic
1124078404 15:26468664-26468686 GAAAATGTACATGTACACCATGG + Intergenic
1124657498 15:31520910-31520932 GAAAATGTATATATATACCATGG + Intronic
1125346603 15:38724878-38724900 GGAAATGTACGTATATACCATGG - Intergenic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1126208113 15:46069515-46069537 GCAAATTTACTTATACAGAAGGG + Intergenic
1126269577 15:46798772-46798794 GAAAGTGTACATATACACAATGG + Intergenic
1126489456 15:49220444-49220466 GAAAATGTATATATACACAATGG - Intronic
1126717425 15:51534038-51534060 CCAAATGTACAAATACAGAATGG + Intronic
1126927780 15:53609795-53609817 GATGATTTACATATACAGCCAGG + Intronic
1127098617 15:55538707-55538729 GAAAAAATATGTATACAGCAAGG + Intergenic
1127154876 15:56113282-56113304 GAAAATGTACATATACACCATGG + Intronic
1127155273 15:56117831-56117853 GAAAATGTATATATACACAATGG - Intronic
1127169666 15:56287881-56287903 GAAAATATATATATACACAACGG - Intronic
1127174059 15:56335279-56335301 GAAAATGTACATATACACAATGG + Intronic
1128057177 15:64708879-64708901 AAAAATGTACATATAGACAACGG - Intergenic
1128179990 15:65593792-65593814 GCAAATCTATATATACAGAAAGG + Intronic
1129045889 15:72733634-72733656 CAAAATGTAAATGTACACCATGG - Intronic
1129559275 15:76549389-76549411 AAATATGCACATATACACCATGG + Intronic
1129593976 15:76944739-76944761 GAAAATGTACATATACACAATGG - Intronic
1129866391 15:78911902-78911924 GAAAATGTATATATACACAGTGG + Intergenic
1130365649 15:83235912-83235934 GTATATGTACATATCAAGCAAGG - Intergenic
1130439432 15:83937290-83937312 AAAAATGTACATATACACCATGG + Intronic
1130768490 15:86899168-86899190 GAAAATGTACATATACACCATGG + Intronic
1131290713 15:91104551-91104573 CAAAATGTACAGATACAGGGAGG + Intronic
1131362929 15:91810199-91810221 AAAAATGTAAATATGCAGAATGG + Intergenic
1131414436 15:92241353-92241375 GAAAATGTATATATACACAATGG - Intergenic
1131591351 15:93752421-93752443 GAAAATGTACATTTACACCATGG + Intergenic
1131922778 15:97348216-97348238 AAGTATGTACATACACAGCAAGG + Intergenic
1132429603 15:101749911-101749933 GAAAATGTATAGACCCAGCATGG + Intergenic
1132477300 16:147014-147036 GAAAATGAACACATATAACATGG + Intergenic
1133158422 16:3892132-3892154 GAAAATGTAAACATCCAGCCAGG - Intergenic
1133687549 16:8180372-8180394 AAAAATGAATATATACAGAAGGG + Intergenic
1134869594 16:17639649-17639671 ATATATGTACATATACACCATGG - Intergenic
1135199563 16:20425345-20425367 GAAGATGTACATATACACAATGG - Intronic
1135219131 16:20598263-20598285 GAAAATGTACATATACACAATGG + Intergenic
1135746619 16:25022427-25022449 GATAAAGTAGATACACAGCATGG - Intergenic
1135755688 16:25095912-25095934 GATAAAGTAGATACACAGCATGG - Intergenic
1135837947 16:25844831-25844853 GAAAATGTACATATACACCAGGG + Intronic
1136644347 16:31597051-31597073 GAAGATGTACATACATTGCAAGG + Intergenic
1136660771 16:31759521-31759543 GAAGATGTACATACATTGCAAGG - Exonic
1136739984 16:32510397-32510419 GAAAATGTCCATTTGCAGAATGG + Intergenic
1137356978 16:47776393-47776415 GAAAATGTACCTATACAGAATGG + Intergenic
1137824382 16:51478169-51478191 GAAAATGTATATATACACAATGG - Intergenic
1137951685 16:52789821-52789843 GAAAATGTGCATATACCCCATGG - Intergenic
1138218816 16:55231760-55231782 GAAATTGTACATATACACGATGG - Intergenic
1138233538 16:55359476-55359498 GAAAATGTATGTATACACCATGG + Intergenic
1138908999 16:61373916-61373938 GAAAATGGACTAATACACCAAGG + Intergenic
1139299540 16:65933678-65933700 GAAAATGGACTAATACAGAAGGG + Intergenic
1139610417 16:68052936-68052958 CAAAATGTACATACATAGCCGGG - Intronic
1140125529 16:72114891-72114913 GGAAATGTACATACACACCATGG - Intronic
1140548555 16:75837039-75837061 GAAAAAGGACATATCCAGCAAGG - Intergenic
1140655796 16:77138001-77138023 GAAAATGTACATATACACCATGG - Intergenic
1141049544 16:80747954-80747976 GAAAATGAACAAATATAGAATGG - Intronic
1141075299 16:81000977-81000999 AAATATGTACATATACACCATGG + Intronic
1142017838 16:87760735-87760757 GAAAATGTACATTTACAGCCAGG + Intronic
1142299109 16:89246465-89246487 TTACATGTACATATACACCATGG + Intergenic
1203012032 16_KI270728v1_random:303249-303271 CAAAATGTTCATTCACAGCATGG - Intergenic
1203012925 16_KI270728v1_random:316940-316962 GAAAATGTCCATTTGCAGAATGG - Intergenic
1203030367 16_KI270728v1_random:576408-576430 CAAAATGTTCATTCACAGCATGG - Intergenic
1203031260 16_KI270728v1_random:590099-590121 GAAAATGTCCATTTGCAGAATGG - Intergenic
1203040461 16_KI270728v1_random:744332-744354 GAAAATGTCCATTTGCAGAATGG + Intergenic
1203041354 16_KI270728v1_random:758023-758045 CAAAATGTTCATTCACAGCATGG + Intergenic
1143601688 17:7950740-7950762 GAAAATGTACATATACACCATGG + Intergenic
1143702106 17:8668449-8668471 GAAAATGTATATAGACACAATGG - Intergenic
1143849347 17:9798185-9798207 GAATATGTGTATATAAAGCATGG - Intronic
1144009369 17:11131696-11131718 GAAAATGTATATATACATGATGG - Intergenic
1145212273 17:21022959-21022981 GAAAATGTACATATATACCATGG + Intronic
1145280805 17:21465594-21465616 AAATGTGTACATATACACCATGG + Intergenic
1145397108 17:22504970-22504992 AAATGTGTACATATACACCATGG - Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1149916984 17:60619246-60619268 GAAAATGTATGTATACACAATGG - Intronic
1150056848 17:62024893-62024915 GAAAATGTGCATGTACACCATGG - Intronic
1151060522 17:71087588-71087610 GAAAATGTGTATATACATAATGG - Intergenic
1151843364 17:76633608-76633630 GAAAATATATATATACAGAGAGG - Intronic
1153740085 18:8115789-8115811 GAAAATGCACATGTACATCATGG - Intronic
1153939269 18:9963514-9963536 GAAAATGTAAAAATACTGTAAGG + Intergenic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154407937 18:14113081-14113103 GCCAATGTACATATACACAAAGG - Intronic
1155110081 18:22706205-22706227 GATATGGTACATATACACCATGG + Intergenic
1155131302 18:22937402-22937424 AAAAAAGTATATATACATCATGG - Intronic
1155425281 18:25700561-25700583 GAAAACTGAGATATACAGCAGGG + Intergenic
1155662375 18:28264773-28264795 GAAAATGTACATATACACCATGG - Intergenic
1155683445 18:28518202-28518224 AAAATGGTACATATACACCATGG + Intergenic
1156067570 18:33162791-33162813 AATACGGTACATATACAGCATGG - Intronic
1156292374 18:35759251-35759273 GAATATGTACCTATACACAATGG + Intergenic
1156783950 18:40886138-40886160 GAAAATGTTCATAAATAACATGG - Intergenic
1156993372 18:43437465-43437487 GAAAATGTACATATATACAATGG - Intergenic
1157698904 18:49747012-49747034 GAAAATGGACTAATACAGGAGGG + Intergenic
1158307736 18:56125188-56125210 GAAAATGTACATGTATACCATGG + Intergenic
1158372630 18:56826778-56826800 GAAAAAATACATTTACAGAAAGG - Intronic
1158709670 18:59826143-59826165 AAAATGGTACATATACACCAAGG - Intergenic
1158842564 18:61403864-61403886 GAAAATGTACATATACACCATGG + Intronic
1158895929 18:61912871-61912893 AAGAATTTACATTTACAGCAGGG + Intergenic
1159304821 18:66627015-66627037 GAAAATGTACACATACACTGTGG + Intergenic
1159376045 18:67594841-67594863 GAAAATGTATATAGACACAATGG - Intergenic
1159487837 18:69088512-69088534 GAAAAAATATCTATACAGCAAGG + Intergenic
1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG + Intronic
1159749572 18:72283531-72283553 GAAAATGGACTAATACAGAAAGG - Intergenic
1159799538 18:72880299-72880321 GAAAATGGACTTATACAGTTGGG + Intergenic
1159855083 18:73577236-73577258 GCAAATGGAAATTTACAGCAAGG + Intergenic
1160233130 18:77063871-77063893 GTATAGGTATATATACAGCATGG - Intronic
1160262744 18:77310337-77310359 GAAAATGTATTTATACATCGTGG + Intergenic
1161777885 19:6273696-6273718 CTAAATGTACATATACATCATGG + Intronic
1162043967 19:7986781-7986803 AAAAATGTCCAGATACAGGAAGG + Intronic
1162219198 19:9161631-9161653 GAAAATGTACGTCTGTAGCATGG + Exonic
1164280625 19:23765419-23765441 GAAAATGTACATATAAAACATGG + Intronic
1164408778 19:27979109-27979131 GAAAAGGTACATGTACACAATGG + Intergenic
1164443192 19:28295212-28295234 GAAAATGTACTTATACACAATGG - Intergenic
1165883399 19:39059534-39059556 GAAAATGTACATATGCACAGTGG - Intergenic
1166598139 19:44069611-44069633 GGAAATGGACATATACACAATGG - Intergenic
1167879992 19:52449213-52449235 GAAAATGTATATATAGACAATGG - Intronic
1167909010 19:52686321-52686343 GAACATATACATGTACAGAAAGG + Intronic
1168165494 19:54544431-54544453 AAAGTTGTACATATACACCACGG - Intronic
1168547050 19:57261545-57261567 GTAAATGGCCATACACAGCAGGG + Intergenic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
926653006 2:15367086-15367108 GCAAATGTATATTTAGAGCAAGG - Intronic
927098764 2:19770525-19770547 GAAAATGGACTAATACAACATGG - Intergenic
927333488 2:21893122-21893144 GGAAATGTACACATACACCATGG - Intergenic
927362852 2:22256549-22256571 GAAAATGTACATATATATGACGG - Intergenic
927567929 2:24130171-24130193 GAAAATGTACATATACACCATGG - Intronic
928133790 2:28672852-28672874 GAGAATGGACTAATACAGCATGG + Intergenic
928710040 2:33994118-33994140 AATATAGTACATATACAGCATGG + Intergenic
928731788 2:34240147-34240169 GTCAATGGAGATATACAGCATGG - Intergenic
928777416 2:34782220-34782242 GAAAATGTATATATACACAATGG + Intergenic
928790828 2:34950697-34950719 GAAAATATATATATATACCATGG + Intergenic
928848955 2:35718313-35718335 GAGAATGAACTAATACAGCATGG + Intergenic
929053980 2:37860251-37860273 GTAAATGTACACTTCCAGCAAGG - Intergenic
929053981 2:37860258-37860280 GGAAGTGTACATTTACATCAAGG + Intergenic
929273982 2:40005753-40005775 GAAAATGGACTAATACACCAGGG - Intergenic
930320685 2:49851223-49851245 GACAATGTATATATACAGTTTGG - Intergenic
930380495 2:50621891-50621913 GAAACTGTAGTTATACAGCCGGG - Intronic
930455273 2:51600373-51600395 AATATTGTACATATACACCATGG - Intergenic
930638870 2:53835114-53835136 GAAAATGTGTATATACACAATGG + Intergenic
930735746 2:54776812-54776834 ACAAATGTTCATATAAAGCAAGG - Intronic
931530048 2:63203912-63203934 GAAAATGTATATATGCACAATGG - Intronic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932121884 2:69108825-69108847 GAAAATGTATATATACACCGTGG - Intronic
932256322 2:70290629-70290651 GAAAATGTAAATATAAAACAAGG + Intronic
933453502 2:82490492-82490514 GAAATAGGACATATACACCATGG - Intergenic
933529846 2:83494351-83494373 AGAAATGTACAAGTACAGCAAGG + Intergenic
933641419 2:84764787-84764809 GGAAATGTATATATACACCATGG - Intronic
933874517 2:86605430-86605452 GAAACTGTAAATAAACAGCTAGG + Intronic
933904881 2:86882084-86882106 GAAAATGTATATATACACCATGG + Intergenic
935121721 2:100188869-100188891 CAAAATGTGCATATACACAATGG - Intergenic
935309981 2:101773923-101773945 GAAAATGTACTTATACACAATGG - Intronic
935851797 2:107229721-107229743 GAAAATGTATATATACACCATGG - Intergenic
936367347 2:111870078-111870100 GAAAATGTATATATACACCATGG - Intronic
936783735 2:116067353-116067375 GGAAGTGTACATATACACCATGG + Intergenic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
937345012 2:121120027-121120049 GAAAATGGACTAATACAGTAGGG - Intergenic
937445409 2:121953274-121953296 AAAGTGGTACATATACAGCATGG - Intergenic
937446747 2:121964870-121964892 AAAAATGTACATATACATCATGG + Intergenic
937550255 2:123079639-123079661 AATACTGTACATATACATCATGG - Intergenic
937731376 2:125234796-125234818 GAAAATGTACATACACGCCATGG - Intergenic
937783226 2:125864177-125864199 GCATATATACATATACAACAAGG - Intergenic
938761740 2:134432255-134432277 GACACTGTAAATATATAGCATGG + Intronic
939062790 2:137444225-137444247 GAAAATGTATACATTCACCAAGG + Intronic
939365444 2:141224602-141224624 GAAATGGTACATATATATCATGG + Intronic
940443173 2:153744037-153744059 AAAATTGTACATATACATAATGG - Intergenic
940675152 2:156718255-156718277 GAAAATGTACATATACACCATGG + Intergenic
940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG + Intronic
940779060 2:157914147-157914169 GAAAAGGTATATATACACCATGG + Intronic
941539823 2:166768266-166768288 AAAATGGTACATATACACCATGG - Intergenic
941590318 2:167411836-167411858 GAAAATGTATATATACAGAATGG + Intergenic
942813817 2:180027876-180027898 GAAAATGTACTTATATACAATGG - Intergenic
943040509 2:182798956-182798978 AAAAATGCACATATTCAGTATGG + Intergenic
943085769 2:183309074-183309096 GCAAATGTACATATGCACCATGG - Intergenic
943161102 2:184252412-184252434 GAAAATGTATTTATACACAATGG + Intergenic
943200874 2:184822192-184822214 GAAAATGTACATATACACCATGG + Intronic
943442339 2:187941373-187941395 GAAAATGTAAATTTAGTGCAAGG - Intergenic
943605064 2:189967331-189967353 GAAACTGTAGATATACAACAAGG - Intronic
943963427 2:194298196-194298218 AAATGTGTACATATACACCATGG - Intergenic
944085827 2:195847274-195847296 CAAATGGTACATATACACCATGG + Intronic
944291285 2:198008566-198008588 GAAAATGTAAATATATACAATGG - Intronic
944882738 2:204030396-204030418 GAAAATGTGCACTTTCAGCAAGG - Intergenic
945058251 2:205886589-205886611 TAAAATGTATATATATAGCCGGG + Intergenic
945339386 2:208633474-208633496 AATGTTGTACATATACAGCATGG - Intronic
945479647 2:210330003-210330025 GAAAATGTACATACACACCATGG - Intergenic
945512291 2:210717516-210717538 GAAAATGTAGGAATACAACAGGG + Intergenic
945570397 2:211459783-211459805 GAAAATGGACTAATACAGGAGGG + Intronic
945621052 2:212137535-212137557 GAAAATGTACATATACACCATGG - Intronic
945730721 2:213529721-213529743 GAAAATGTACATTAAAAACATGG + Intronic
945760458 2:213907651-213907673 GAAAATGTATATATACACAATGG + Intronic
945774246 2:214084626-214084648 GTAAATGTACATATAAAGTTGGG - Intronic
945822453 2:214681121-214681143 GAAAATGTGTATATACTGGATGG + Intergenic
945838828 2:214864600-214864622 GAAAATGTACATATACGCAGTGG + Intergenic
945909879 2:215636257-215636279 TAAAATGAACATTCACAGCAAGG + Intergenic
946169913 2:217888844-217888866 GAAAATGGACTAATACACCAGGG + Intronic
946531380 2:220574063-220574085 GAAAATGGACTAATACAGAAGGG - Intergenic
946553939 2:220833683-220833705 GGAAATGCAAATATACCGCATGG + Intergenic
946680113 2:222204926-222204948 AAAAATGTACATATAGCTCATGG - Intronic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
1168827963 20:826678-826700 GAAAACGAACTAATACAGCACGG + Intergenic
1169083672 20:2814340-2814362 GAAAATGAACATATAATGAAGGG - Intergenic
1169295740 20:4396330-4396352 GCAAATGTATATATACACAATGG - Intergenic
1169841311 20:9940855-9940877 GCAAATGTACATATATAGAGGGG + Intergenic
1171092085 20:22294785-22294807 GAAAATGGACTAATACAGAAGGG + Intergenic
1172402486 20:34661577-34661599 GAAAATGTACATATACACCATGG - Intronic
1172422278 20:34827473-34827495 TAAAATGTACATATACACAATGG - Intergenic
1172909968 20:38401346-38401368 GAAAATGGACAAATACACTATGG - Intergenic
1173172196 20:40736453-40736475 GAGAATGGACTAATACAGCAAGG - Intergenic
1173275308 20:41575268-41575290 CAAAATGTACAAACAAAGCAAGG - Intronic
1173642261 20:44611980-44612002 GAAAATGTATATATACACAAAGG - Intronic
1174946143 20:54987876-54987898 CAAAATTAACATATACAGCATGG - Intergenic
1175587651 20:60157617-60157639 GAAAATGTACATATACACCATGG + Intergenic
1177022518 21:15880741-15880763 GAAAACGTACATATACGCCATGG - Intergenic
1177421525 21:20864437-20864459 GAAAAAATATATATACACCATGG - Intergenic
1178231933 21:30795739-30795761 TACAATGTATATATACACCATGG + Intergenic
1178616726 21:34141066-34141088 GAAAAGGAACAAATTCAGCAAGG - Intronic
1180736065 22:18018425-18018447 AAAAATATACATATACAGGCTGG + Intronic
1181691716 22:24566233-24566255 GAAACTGCTCATATACAACAGGG + Intronic
1181794608 22:25296493-25296515 AATAAGGTACATATACACCATGG - Intergenic
1181896842 22:26117214-26117236 GAAAATGTACATGTACGCTATGG + Intergenic
1182223575 22:28777800-28777822 GAAAATTTGCATAAACAGCCAGG - Intronic
1182661584 22:31929030-31929052 CAAAATGTTCATTTTCAGCAGGG - Intergenic
1182758784 22:32704425-32704447 GAAAATGTACATATACACCATGG - Intronic
1183805663 22:40208416-40208438 GCAAATGTATAAATACAGCGTGG + Intronic
949188742 3:1225341-1225363 TAAACTGTACATATAGATCAGGG - Intronic
949386861 3:3512524-3512546 GAAAATGTACATATACACCATGG + Intergenic
949575031 3:5330885-5330907 GAAAATGGACTGATACAGGAGGG - Intergenic
949698447 3:6727338-6727360 GAAAATGTATATATACACAATGG - Intergenic
951096502 3:18638055-18638077 GAAAATGTACATATACACAATGG + Intergenic
951128782 3:19016540-19016562 GAAATTGTATTTATACAGGAGGG + Intergenic
951209623 3:19960630-19960652 TAAAGTTTACATATACATCAAGG - Intronic
951269863 3:20610861-20610883 GAAAATGTACCTATACACCATGG + Intergenic
951380242 3:21975193-21975215 GAAAATGTACATATACACAATGG + Intronic
951492320 3:23285239-23285261 GAAAATGGACACATACACAACGG - Intronic
951800736 3:26593187-26593209 TAAAATGAATATATACAGCATGG - Intergenic
951859500 3:27236334-27236356 CAAAATGTATATATACACTATGG + Intronic
952149528 3:30573147-30573169 GAAAACGTACATATACATGATGG + Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
952703239 3:36348654-36348676 ACAAATGTACATAAAGAGCAGGG + Intergenic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
953357868 3:42269604-42269626 CATAATGTACATACATAGCAAGG - Intergenic
955160057 3:56456396-56456418 TAAAAAGTACATATTCAGAAAGG - Intronic
955207257 3:56907650-56907672 AAAGTTGTACATATACACCATGG + Intronic
955265554 3:57440307-57440329 GCAAATGTACATATATACCATGG + Intronic
956350746 3:68333276-68333298 GAAAATGCAAATATACACCATGG + Intronic
956589596 3:70899757-70899779 GAAAATGTACATGGACAAAAAGG - Intergenic
956956790 3:74350703-74350725 AATATGGTACATATACAGCATGG + Intronic
957380415 3:79421004-79421026 CAAAATGTACATATACACCATGG + Intronic
958029141 3:88086394-88086416 TAAAAAGTACTTACACAGCAAGG - Exonic
959128292 3:102318171-102318193 GAAAATATACATCTACACCATGG - Intronic
959245330 3:103861136-103861158 GAAAATGTATATATACACCATGG - Intergenic
959252381 3:103965320-103965342 GAAAACATACATATACAACATGG + Intergenic
959667037 3:108933963-108933985 AACATTGTACATATACACCATGG + Intronic
959956319 3:112242311-112242333 GAAAATATACATATACACAATGG + Intronic
960033797 3:113082900-113082922 GAAAATGTACATATACACTATGG + Intergenic
960242955 3:115366857-115366879 GAAAATGTATATATACACCATGG + Intergenic
960306817 3:116071957-116071979 AAAAAGCTACATATACACCATGG - Intronic
960313655 3:116149197-116149219 GAAAATCTAACTATACTGCAGGG - Intronic
960415985 3:117385801-117385823 GAAAATGCACATTTACACAATGG + Intergenic
960791977 3:121442651-121442673 GAAAATGTACAGGTACACAATGG - Intronic
961175130 3:124829163-124829185 GAAAATGTAGATAAGCAGAAAGG - Intronic
961231511 3:125316208-125316230 GAAAATGTACATATGCACAATGG - Intronic
961334626 3:126164581-126164603 TAAAATGTACATATACACCATGG - Intronic
961716434 3:128860625-128860647 GTAAATGTTCTTATCCAGCATGG - Intergenic
961927551 3:130497299-130497321 AAAAATGTATATATACACAATGG - Intergenic
961931744 3:130540865-130540887 GAACTGGTACATATACACCATGG - Intergenic
962322500 3:134403449-134403471 GAAAATGAACTAATACACCATGG + Intergenic
962684276 3:137831603-137831625 GCAAAAGTACATATACAGGTAGG + Intergenic
962910133 3:139840582-139840604 AAGAAAGTACATATACACCATGG - Intergenic
963333124 3:143938727-143938749 GATATGGTACATATACACCATGG + Intergenic
963471466 3:145747419-145747441 GAAAATGAACTAATACAGCATGG - Intergenic
963594793 3:147312459-147312481 GAAAACGTATATATACAAAAAGG + Intergenic
963858676 3:150283666-150283688 GAAAATGTACATATACACAATGG + Intergenic
964002240 3:151788973-151788995 AAAAATGTAGATATACAGGCCGG + Intergenic
964208981 3:154207876-154207898 GAAAATGTACATATACACCATGG + Intronic
964427336 3:156567957-156567979 AGAAATGTACATAAATAGCAAGG + Intergenic
964487030 3:157196731-157196753 GAAAATGTTCATGTACACCATGG + Intergenic
964810451 3:160657866-160657888 AATATAGTACATATACAGCATGG - Intergenic
965074110 3:163954122-163954144 GAAAATGTACTTATGCACCATGG + Intergenic
965142444 3:164856118-164856140 CAAACTGTACATACACATCATGG - Intergenic
965152906 3:165005208-165005230 GAAAATAGACTAATACAGCAGGG + Intronic
965407131 3:168284277-168284299 GAAACTGTACATATACACATAGG - Intergenic
965726589 3:171723334-171723356 GAAAATGTACATACACATGATGG - Intronic
965789205 3:172369613-172369635 AAAAAGGTCCATATACAGCCAGG + Intronic
965797406 3:172455145-172455167 GAAAATACACATTTATAGCAGGG + Intergenic
965849750 3:173009774-173009796 GAAAATGCACACACAAAGCAAGG + Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
966517763 3:180837974-180837996 GAAAATGTACATATACACCATGG + Intronic
966627708 3:182036634-182036656 GAAAATGGACTAATACAGAAAGG - Intergenic
967213044 3:187185666-187185688 GAAAATGTAAATCTTTAGCAGGG + Intergenic
967593570 3:191305033-191305055 TAAAATGTACATATATACCATGG - Intronic
967866002 3:194190362-194190384 GAAAATGTACATATACACCATGG - Intergenic
969225481 4:5795093-5795115 GAAATGGTATATATACACCATGG - Intronic
969950365 4:10829348-10829370 GAAAAACTACATATACAGTAAGG + Intergenic
970044362 4:11833743-11833765 GAAAATGTACATATATACCATGG - Intergenic
970056046 4:11973027-11973049 TAATATGTAAATATATAGCAGGG + Intergenic
970130303 4:12862380-12862402 GAAAATGTAGATATAATTCAGGG - Intergenic
970296441 4:14635931-14635953 TAAAACGTGCATATACAGGAAGG - Intergenic
971021839 4:22545206-22545228 GAAAATGTACTAATACAGGAGGG - Intergenic
971643761 4:29169231-29169253 GAAAATGTACATAAAATGTAGGG + Intergenic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
971729350 4:30357198-30357220 GAAAATGTACATATACACCATGG - Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
972294158 4:37720533-37720555 GAAAATGTATATATACATCATGG + Intergenic
972792560 4:42387112-42387134 GAAAATGTACTAATACACCATGG - Intergenic
973064575 4:45772844-45772866 GAAAATGCACATATACCCCATGG - Intergenic
973081298 4:45997197-45997219 GAGAAAGAACAAATACAGCAGGG - Intergenic
974711155 4:65596992-65597014 GAAACAGTACAGTTACAGCAGGG - Intronic
974785406 4:66613396-66613418 AAAATGGTACATATACACCATGG - Intergenic
974946129 4:68530797-68530819 AAATGTGTACATATACACCATGG - Intergenic
975095052 4:70448148-70448170 CAAATTGTACATACACAGAATGG - Intronic
975237191 4:72013304-72013326 GAGAATGGACTAATACAGCATGG - Intergenic
975452582 4:74546777-74546799 GTAAATGTAAATATAAAGAAGGG - Intergenic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
975880221 4:78896877-78896899 GAGCATGTACATTTACAGAATGG + Intronic
976731963 4:88271684-88271706 GTAAATCTACAGTTACAGCATGG + Intronic
976892671 4:90069033-90069055 GAAAATGAACTAATACAGTATGG + Intergenic
976900991 4:90175891-90175913 GAAAATGTATATAAACAAAATGG + Intronic
976980690 4:91223184-91223206 GAAAATGTAAAAATATATCAAGG + Intronic
977159431 4:93614747-93614769 ACAAATGTAAATATCCAGCACGG - Intronic
977192970 4:94023327-94023349 AAAAGGGTACATATACACCATGG + Intergenic
977353873 4:95920863-95920885 CAACATGTACATATACAATATGG - Intergenic
977367619 4:96090954-96090976 AAAAATGTATATATACACAATGG + Intergenic
977458308 4:97291952-97291974 AAAAATGTACATATACACAATGG - Intronic
977801181 4:101234104-101234126 GAAAATGTACATATACGCCATGG - Intronic
978547207 4:109883725-109883747 GAAAATGTACATATACATAACGG + Intergenic
979158089 4:117423531-117423553 GAAAATGTACATATACACAATGG - Intergenic
979208505 4:118071625-118071647 GAAAATGTAAATATATGCCATGG - Intronic
979506543 4:121503477-121503499 GAAAATGTATATATACACCATGG - Intergenic
979616902 4:122753115-122753137 AAAATTGTACATATACACAATGG + Intergenic
979703225 4:123690872-123690894 GAATACATACATATACAGCAAGG + Intergenic
979742880 4:124173427-124173449 AAACATGTACATATACACCATGG + Intergenic
980267838 4:130543004-130543026 GAAAATGCACAAACAAAGCAAGG + Intergenic
980519493 4:133911925-133911947 GAAAATGTACATATAAACCATGG + Intergenic
980751868 4:137100891-137100913 GAAAATGTACATATACATCAAGG + Intergenic
981221680 4:142244270-142244292 AAAAAGGCACATATACACCATGG - Intronic
981467539 4:145091558-145091580 GAAAATGTACATATACACTATGG - Intronic
981924394 4:150122386-150122408 GCAAATGCACATATACACCATGG + Intronic
982028918 4:151279478-151279500 GAAAATTTAAATATAAAGGAAGG + Intronic
982195204 4:152904755-152904777 GAAAATGTACATATACACCATGG - Intronic
982498471 4:156122486-156122508 GCAAATGTAGATATACAAAATGG + Intergenic
982632735 4:157852773-157852795 GAAAATGTACATATACACCATGG - Intergenic
982634530 4:157876870-157876892 GAAAATATATATATATATCATGG - Intergenic
982829390 4:160042175-160042197 GAAAATGAACTAATACACCAGGG - Intergenic
982997363 4:162366579-162366601 GAAAATGTAATTATACACCATGG - Intergenic
983128477 4:163984294-163984316 GAAAATGTACATATAAACAAAGG + Intronic
983128500 4:163984523-163984545 GTAAGTGTAGAGATACAGCATGG - Intronic
983387311 4:167081790-167081812 GAAAATATATAGATACAGAATGG + Intronic
983432515 4:167669664-167669686 GAAAATGTATATATACACAGTGG - Intergenic
983663317 4:170154381-170154403 GCCACTGTACATATACACCATGG - Intergenic
983743978 4:171171092-171171114 GAAAATGTACCCACAAAGCAGGG - Intergenic
984018104 4:174450086-174450108 GGAAATGTCCATTTCCAGCAGGG + Intergenic
984492862 4:180457635-180457657 GAAAAAGGACATAAGCAGCATGG - Intergenic
984906397 4:184630810-184630832 GAAAATATGCATATATAGCCAGG - Intronic
985044359 4:185925270-185925292 AAATATGTACATGTACAGCTGGG + Intronic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
985236029 4:187875358-187875380 GAAAATGTACATATATACCATGG - Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986296280 5:6441338-6441360 GAAAATGTACATATACACCAAGG - Intergenic
986945393 5:13012287-13012309 GAAACTGTACAGATACACCATGG - Intergenic
987490515 5:18575280-18575302 GAAAATGTACATATACACCATGG + Intergenic
988005743 5:25407912-25407934 AAATGTGTACATATACACCATGG - Intergenic
988701460 5:33679275-33679297 GAAAATGGACTAATACAGGAAGG - Intronic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989244637 5:39240950-39240972 GAAAATGTACATATACACCATGG + Intronic
989297518 5:39847285-39847307 GAAAATATACATATACACCACGG - Intergenic
989340955 5:40375159-40375181 AAAAATGCACATAAATAGCACGG + Intergenic
989610353 5:43284901-43284923 GAAAATGTATATAAACACAATGG - Intergenic
989693932 5:44177015-44177037 GAAAATGTATATATACACCATGG - Intergenic
989848944 5:46183513-46183535 CCAAATGTCCATTTACAGCATGG + Intergenic
989969677 5:50507853-50507875 AAATATGTACATATACACCATGG + Intergenic
990161065 5:52941138-52941160 AAATATGTACATATACACCATGG - Intronic
990164641 5:52981208-52981230 GAAAAATTACACATGCAGCAGGG + Intergenic
990215381 5:53526020-53526042 GAAAATGTACATGTACACCATGG - Intergenic
990228922 5:53689390-53689412 GAAAATGTACGTATACACCCTGG + Intergenic
990629176 5:57649175-57649197 CATGATGTACATATACACCATGG - Intergenic
991228243 5:64298224-64298246 GAAAATGTACATTTACACCATGG - Intronic
991229398 5:64313514-64313536 GGAAATGTACACATACACCATGG - Intronic
991316000 5:65307590-65307612 TACAATTCACATATACAGCAAGG + Intronic
992297865 5:75344394-75344416 GAAAATGTACCTTTACAGCATGG - Intronic
992900956 5:81294886-81294908 AAATATGTACATATACACCATGG + Intergenic
992954965 5:81898964-81898986 GAAAATGCATATATACACTATGG + Intergenic
993083017 5:83325668-83325690 AAATATGTACATATACACCATGG - Intronic
993221390 5:85101931-85101953 GAAAATGTACATATACACCATGG + Intergenic
993484324 5:88463686-88463708 GAAAATGTATATATACACCATGG - Intergenic
993540651 5:89146599-89146621 GAAAATCTACATATACTATATGG + Intergenic
993581183 5:89662843-89662865 GAAAATATACTTTTATAGCATGG + Intergenic
993734960 5:91465390-91465412 AAAATGGTACATATACACCATGG + Intergenic
993794981 5:92255808-92255830 AAAAATGCACATATACACCATGG - Intergenic
993960410 5:94290492-94290514 AAATATGGACATATACACCATGG - Intronic
994225597 5:97248950-97248972 GAAGTGGTACATATACACCATGG + Intergenic
994351184 5:98748407-98748429 GAAAATGTACATATACACCATGG + Intergenic
994354407 5:98778873-98778895 GAAAAAGTAAATATATAGCTTGG + Intronic
994472559 5:100226767-100226789 AAAAATGTACATATACACCATGG - Intergenic
994663134 5:102676880-102676902 GCACATATACATATACACCATGG + Intergenic
994846502 5:104995001-104995023 AAAATTGTACATATACATGATGG - Intergenic
995117517 5:108498641-108498663 AAAAATGTATATATACACCATGG - Intergenic
995144698 5:108773554-108773576 AAAAGTGTACATATATACCATGG - Intronic
995154046 5:108889330-108889352 GGAAATGTACCTATACACAATGG + Intronic
995431082 5:112078310-112078332 GAAAATGTACACATACATCATGG - Intergenic
995554969 5:113318463-113318485 AAAATGGTACATATACACCATGG + Intronic
995562532 5:113398461-113398483 GAAAATGCACATATATACCATGG + Intronic
995900691 5:117062824-117062846 AAATGTGTACATATACACCATGG + Intergenic
996134476 5:119822632-119822654 GTAAGTGTACATATACAGGATGG + Intergenic
996333134 5:122353826-122353848 GAAAATGGACTAATACGGCAGGG + Intronic
996580231 5:125024071-125024093 GAAAATGTAAATATATAGCCTGG - Intergenic
996630626 5:125627169-125627191 GAATATGTAATTATACAGGAAGG + Intergenic
996997965 5:129721959-129721981 AATATTGTACATATACAACATGG - Intronic
997301374 5:132808218-132808240 TAAAATGTATATTTATAGCAAGG - Intergenic
997750823 5:136344058-136344080 GAAAATGTACATAAATACCATGG + Intronic
997785993 5:136714512-136714534 GAAAATGTACATATACACCATGG - Intergenic
998687716 5:144548750-144548772 GAGAATGGACTAATACAGCATGG + Intergenic
998731887 5:145087354-145087376 AATATTGTACATATACAGAATGG - Intergenic
1001889288 5:175325760-175325782 GACAATTTACCTAAACAGCAAGG + Intergenic
1002015408 5:176317869-176317891 CAAAATGTACAAACAAAGCAAGG + Intronic
1003348484 6:5293463-5293485 TATAATGTAGATATACAGAATGG - Intronic
1003581773 6:7347026-7347048 AAAAATGTAAATATTCTGCAGGG - Intronic
1003703415 6:8496102-8496124 AAAATGGTACATATACACCATGG - Intergenic
1003822419 6:9913783-9913805 GAAAATGTACATGTACATCATGG - Intronic
1004445023 6:15690159-15690181 GAAAATCTAAATTTACAGAACGG + Intergenic
1004624331 6:17360630-17360652 GAAAATGTACATATACATCACGG + Intergenic
1005341538 6:24848066-24848088 GAGAATGTCCATGTACAGCCAGG - Exonic
1005692582 6:28321772-28321794 GAAACATTACATATACAGCAGGG + Intergenic
1005773772 6:29106122-29106144 GAAAATTCACATATACAACATGG - Intergenic
1005909704 6:30297745-30297767 GAAAATGTACATATACACCGTGG - Intergenic
1006018282 6:31100465-31100487 GAAAATGTACATATACATAATGG - Intergenic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1006470455 6:34225869-34225891 GAAAATGCCCTTATTCAGCAAGG - Intergenic
1006484006 6:34322882-34322904 GAAAGTGTACATATACAAAATGG + Intronic
1007051940 6:38840041-38840063 GAAGATGTATATATACAAAATGG + Intronic
1007362076 6:41365915-41365937 GAAAATGTACATATACACAATGG - Intergenic
1007872492 6:45056460-45056482 GAAAATGTATAGGTACATCATGG + Intronic
1007931592 6:45696724-45696746 GAGAAAGGACATATACTGCAAGG + Intergenic
1008022419 6:46595367-46595389 TAAAATGTATATATACATAATGG + Intronic
1008256587 6:49309112-49309134 GAAAATATGCATATACACCATGG + Intergenic
1008431173 6:51419058-51419080 GAAAATGTATATACACACTATGG - Intergenic
1008596980 6:53052260-53052282 GAAAATGTACATATACACCATGG - Intronic
1008724679 6:54402241-54402263 AACAATGCACATATACACCATGG - Intergenic
1008725843 6:54417746-54417768 GCTTGTGTACATATACAGCATGG - Intergenic
1008836619 6:55839681-55839703 GAAAATGTACATATAACCTACGG - Intronic
1009054952 6:58323693-58323715 GAAGAGGTAAAAATACAGCAAGG - Intergenic
1009236203 6:61126883-61126905 GAAGAGGTAAAAATACAGCAAGG + Intergenic
1009492533 6:64310362-64310384 GAAAATGTACATAGACACAATGG + Intronic
1009528085 6:64773339-64773361 GAAAATGTACATATATACCATGG - Intronic
1009611195 6:65943616-65943638 GAAAATTTACAAACATAGCAAGG + Intergenic
1009690730 6:67029389-67029411 GAAAATGTAAATACACAGAGGGG - Intergenic
1010477331 6:76304095-76304117 GAAAATGTACATATACACCATGG - Intergenic
1010839845 6:80635972-80635994 AAATGTGTACATATACACCATGG - Intergenic
1010986574 6:82432129-82432151 GAAAATGTACATAAACTGATTGG - Intergenic
1011223894 6:85086105-85086127 AAAATAGTACATATACATCATGG - Intergenic
1011396249 6:86911926-86911948 GAAAATGTACATACACACCATGG + Intergenic
1011900392 6:92287519-92287541 GAAAATGTACATATACACGATGG - Intergenic
1012092914 6:94921732-94921754 ACATATGTACATATACAGAATGG + Intergenic
1012124329 6:95408634-95408656 AAAAAGGTACATATATACCACGG + Intergenic
1013378806 6:109545684-109545706 GAAAATGGACTAATACACCAAGG + Intronic
1013687790 6:112605621-112605643 GACAATGTACATATACACAATGG + Intergenic
1013808779 6:114021110-114021132 GAAAATGTACGTATACACAATGG + Intergenic
1014081747 6:117295117-117295139 TCAAAGGTACATATACAGAATGG + Intronic
1014155956 6:118110013-118110035 ACAAATGTACAGATACATCACGG + Intronic
1014821586 6:125994735-125994757 GAAAATGTACATATACACCATGG + Intronic
1015044133 6:128759135-128759157 TAAAATGTGCATATACTGAAGGG + Intergenic
1015092123 6:129370992-129371014 TAGAATGTACAGATACAACACGG + Intronic
1015160679 6:130149494-130149516 GAAAATGTACATGTACACCATGG + Intronic
1015607735 6:134976535-134976557 GAAAACGTATATGTACACCATGG + Intronic
1015630493 6:135227514-135227536 CAAAATGTGCAAATAAAGCAAGG - Intergenic
1015850443 6:137566317-137566339 AATATGGTACATATACAGCATGG - Intergenic
1015874961 6:137813787-137813809 GAAAATGAACATGTACTTCATGG - Intergenic
1016237551 6:141886871-141886893 GAGAATGGACTAATACAGCATGG - Intergenic
1016249949 6:142028758-142028780 GAAAATGTATATATACACCATGG - Intergenic
1016346902 6:143123635-143123657 TAAAAAATATATATACAGCAGGG - Intronic
1016421500 6:143889094-143889116 GAAAATGGACATATATTGTAAGG + Intronic
1016497637 6:144682344-144682366 GAAAATGTATTTATACAAAATGG - Intronic
1016601978 6:145872816-145872838 GAAAATGTACATATACAACATGG + Intronic
1016704118 6:147087275-147087297 GCAAATGTATAGATACAGAAAGG + Intergenic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1017390620 6:153935083-153935105 GAAAATTTACATATGCACCATGG - Intergenic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1018689269 6:166331216-166331238 GAAACTAGAAATATACAGCAAGG + Intronic
1019052832 6:169196763-169196785 GAAAATGTGCACACACACCATGG + Intergenic
1019052835 6:169196800-169196822 GAAAATGTGCACACACACCATGG + Intergenic
1019052849 6:169196996-169197018 GAAAATGTGCACACACACCATGG + Intergenic
1019052852 6:169197033-169197055 GAAAATGTGCACACACACCATGG + Intergenic
1019052860 6:169197185-169197207 GAAAATGTGCACACACACCATGG + Intergenic
1019052862 6:169197222-169197244 GAAAATGTGCACACACACCATGG + Intergenic
1019052864 6:169197259-169197281 GAAAATGTGCACACACACCATGG + Intergenic
1019052872 6:169197375-169197397 GAAAATGTGCACACACACCATGG + Intergenic
1019052886 6:169197572-169197594 GAAAATGTGCACACACACCATGG + Intergenic
1019052889 6:169197609-169197631 GAAAATGTGCACACACACCATGG + Intergenic
1019052897 6:169197761-169197783 GAAAATGTGCACACACACCATGG + Intergenic
1019052903 6:169197838-169197860 GAAAATGTGCACACACACCATGG + Intergenic
1019052911 6:169197955-169197977 GAAAATGTGCACACACACCATGG + Intergenic
1019052913 6:169197992-169198014 GAAAATGTGCACACACACCATGG + Intergenic
1019052917 6:169198068-169198090 GAAAATGTGCACACACACCATGG + Intergenic
1019052924 6:169198178-169198200 GAAAATGTGCACACACACCATGG + Intergenic
1019150703 6:170003739-170003761 GAGAATGGACTAATACAGCAAGG - Intergenic
1020152149 7:5690875-5690897 TAAAATGTACACATTCATCATGG + Intronic
1020497503 7:8874907-8874929 AAAAATGTACATATATGACATGG + Intergenic
1020716907 7:11685997-11686019 GAAAATGTACATATACACCATGG + Intronic
1020804300 7:12769366-12769388 GAAAATGTATATATAGACCCAGG + Intergenic
1020808738 7:12825079-12825101 GAAAATGTACATATACACCATGG + Intergenic
1021022609 7:15622514-15622536 TAAAATAAACATATACACCAAGG - Intronic
1021026917 7:15679831-15679853 AAAAATGTATAGATACAGTACGG + Intronic
1021060881 7:16110064-16110086 AAAAATACACATATACAGTAAGG + Intronic
1021454415 7:20814017-20814039 GAAAATGTACACAGAGAGCCGGG + Intergenic
1022513736 7:30962150-30962172 GAACATGTACAGTTAGAGCAGGG + Intronic
1022759599 7:33333413-33333435 GAAAATGTGTATACACACCATGG - Intronic
1022984865 7:35642588-35642610 GAAAAAGTACATATACACCATGG + Intronic
1023443318 7:40206785-40206807 GAAAATGTACATCTTCAGCACGG + Intronic
1023505421 7:40895090-40895112 GAAAATGTACATATTCATCATGG + Intergenic
1023747679 7:43336906-43336928 GAAAATGTATATATACACCATGG - Intronic
1023911078 7:44557061-44557083 GAAAATGTACATATATGTCATGG - Intergenic
1024187246 7:46962900-46962922 GAAAGTGTACATATATATCATGG + Intergenic
1024310089 7:47961213-47961235 CAAAATGGACATATACACAATGG + Intronic
1024316391 7:48022048-48022070 GAAAATGTACATATTCACAATGG + Intronic
1024338625 7:48234914-48234936 CAAAATCTACATAACCAGCATGG - Intronic
1024474582 7:49797046-49797068 TCATATGTACATAGACAGCAAGG - Intronic
1024497590 7:50066162-50066184 GATTATGAACATATGCAGCATGG + Intronic
1024819411 7:53309996-53310018 GAAAATATGCATATAAAGAAAGG + Intergenic
1024955914 7:54920088-54920110 GATAAGGTATAAATACAGCACGG + Intergenic
1025061098 7:55809043-55809065 GAAAATGAACATATACACTATGG + Intronic
1025527480 7:61834066-61834088 GAAAATGTCCATTTGCAGAATGG + Intergenic
1025529103 7:61854490-61854512 CAAAATGTCCATTCACAGCATGG + Intergenic
1025593488 7:62894425-62894447 GAAAATATACATTTGCAGAATGG + Intergenic
1025596414 7:62932855-62932877 CAAAATGTCCATATGCAGAATGG + Intergenic
1025616949 7:63128183-63128205 GAAAACATACATATACACCATGG + Intergenic
1025784256 7:64630084-64630106 GAAAATGTACATATACACCATGG + Intergenic
1025971188 7:66327425-66327447 AAAAATGTATATGTACAGCTGGG + Intronic
1026515195 7:71063483-71063505 AATATTGTACATATACACCATGG + Intergenic
1027337105 7:77163028-77163050 GAATTTGTACAGATTCAGCATGG + Intronic
1027997232 7:85439766-85439788 GAAAACGTACATATATGCCATGG + Intergenic
1028110574 7:86935598-86935620 GAAAATTTACATTTCCAGGAAGG - Intronic
1028898756 7:96072107-96072129 GACAATGTACATATAGAGTCAGG + Intronic
1029274917 7:99398253-99398275 GACAATGTCCAGCTACAGCAGGG + Intronic
1029778694 7:102708082-102708104 GAATTTGTACAGATTCAGCATGG - Intergenic
1029814309 7:103077321-103077343 GAAAATGGACTAATACAGTAAGG - Intronic
1030401511 7:109057439-109057461 GAAAATGTATATATACACCATGG - Intergenic
1030533761 7:110741115-110741137 GAAAATGTTTATATATACCATGG + Intronic
1030805164 7:113908772-113908794 GAAAAAGTATATATACACTATGG + Intronic
1030883709 7:114913590-114913612 GAATATTTGCATATACATCATGG + Intergenic
1031230376 7:119098011-119098033 GAAAATGTATATATACAAATTGG - Intergenic
1031258239 7:119483586-119483608 GAAAATGTATATATACACCATGG - Intergenic
1031825279 7:126557386-126557408 AAAAATGTACAGAGACAGTAAGG - Intronic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032733237 7:134665247-134665269 CAAAGTGCACATATACACCATGG + Intronic
1033143585 7:138851057-138851079 AAAAATGTAAAGATACAGAAAGG - Intronic
1034083610 7:148303124-148303146 GAAAATGGACTAATACACCATGG + Intronic
1034173746 7:149083892-149083914 GAAAATGTACATATGCACTATGG - Intronic
1034381473 7:150698399-150698421 GAAAATGTACATATACACTATGG + Intergenic
1034927885 7:155137847-155137869 AAATGTGTACATATACACCATGG - Intergenic
1035241351 7:157531847-157531869 AAATGTGTACATATACACCATGG - Intergenic
1035785760 8:2259331-2259353 TAAAATGTACAAATCAAGCATGG - Intergenic
1035807047 8:2462385-2462407 TAAAATGTACAAATCAAGCATGG + Intergenic
1035977234 8:4325872-4325894 GACCATGTGCATATACAGAACGG - Intronic
1036017211 8:4798369-4798391 AAAAATGCACATATACACCATGG - Intronic
1036075928 8:5499588-5499610 GAAAATACACATATATACCATGG - Intergenic
1036103607 8:5815290-5815312 GAAAATGTACATATATACCATGG + Intergenic
1037478487 8:19280674-19280696 GAAAATATATATATACACTATGG - Intergenic
1038034824 8:23678369-23678391 TAAAATGTGCATATATACCATGG - Intergenic
1038442080 8:27577874-27577896 GAGTATGTACAAATACACCATGG - Intergenic
1038477895 8:27881333-27881355 GTACATATACATATACACCATGG + Intronic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1038602244 8:28957194-28957216 GAAAATGTACATTTATGCCATGG + Intronic
1038897222 8:31797813-31797835 GAAAATGTATGTATACAGAATGG + Intronic
1038948865 8:32391722-32391744 AATATGGTACATATACAGCATGG - Intronic
1039044451 8:33437125-33437147 GAAAATCTTCATATACACCGTGG - Intronic
1039367349 8:36944244-36944266 GAAAATGTATATATGCACCATGG + Intergenic
1039806344 8:41003059-41003081 GAAAACGTATATATACACCACGG - Intergenic
1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG + Intergenic
1040361327 8:46667338-46667360 GAAAATGTATGTATACACCATGG + Intergenic
1040449891 8:47534411-47534433 GAAAATGTACATATACACCATGG + Intronic
1040541275 8:48358690-48358712 GAAGATCTACATAAACAGAAAGG + Intergenic
1040577578 8:48667255-48667277 GAAAATGAACTAATACAGCCAGG - Intergenic
1040912742 8:52537603-52537625 GAAAATGTGTATATACACAACGG + Intronic
1040945408 8:52880059-52880081 GAAAATGTAGATATAAATCTTGG - Intergenic
1041039114 8:53827970-53827992 GAAAACGTACATATACTCCATGG - Intronic
1041172417 8:55157884-55157906 GAAAATGTACATAGACACCATGG - Intronic
1041296765 8:56364778-56364800 GAGAATGTATATATACACAATGG + Intergenic
1041569168 8:59317141-59317163 GAGAAAATACATATATAGCACGG - Intergenic
1041610801 8:59845839-59845861 GAAAATGTACCTATACACCATGG + Intergenic
1041625501 8:60021140-60021162 AAAAATGTATATATACACCATGG - Intergenic
1042330514 8:67575512-67575534 GAAAATGTATATATACACAATGG + Intronic
1042473601 8:69219774-69219796 AATATTGTACATATACACCATGG + Intergenic
1042501832 8:69516988-69517010 GAAAATGGACTAAGACAGCAGGG - Intronic
1042523939 8:69744614-69744636 GAAGATGTACAGATACCCCAAGG - Intronic
1043397089 8:79849006-79849028 GAAAATGTACATATATGCCATGG + Intergenic
1043398384 8:79859889-79859911 AAAAATGGAGATATACAGCGGGG - Intergenic
1043596014 8:81885726-81885748 GAAAATGTGCATCTGCATCATGG - Intergenic
1043619217 8:82167523-82167545 AAAAATGTGCATTTACAGAAAGG - Intergenic
1043846228 8:85167197-85167219 AATATTGTACATATACACCATGG + Intergenic
1043945441 8:86246168-86246190 GAAAATGTACATATACACAAGGG - Intronic
1044222626 8:89686968-89686990 AAATGTGTACATATACATCATGG - Intergenic
1044293235 8:90497395-90497417 GTTAATGTACATATTAAGCATGG - Intergenic
1044541501 8:93413508-93413530 GAAAACGGACTAATACAGCAGGG - Intergenic
1044568803 8:93695441-93695463 GAAAATGTGTATATATACCATGG - Intergenic
1044826435 8:96202675-96202697 GAAAATATACATATACACGATGG - Intergenic
1044959980 8:97521102-97521124 GAAAAGGTACATATGCACCATGG + Intergenic
1045403895 8:101846036-101846058 GAAAATGTATATATACACAATGG - Intronic
1045959405 8:107949364-107949386 GAAAATGTGGATATACACCATGG - Intronic
1046150482 8:110217792-110217814 GAAAATGTACCTATGCACAATGG + Intergenic
1046202457 8:110945170-110945192 GAAAATGTATATATACACCATGG - Intergenic
1046454940 8:114446415-114446437 GAAAATGTAAATATACATCATGG + Intergenic
1046561828 8:115847346-115847368 AATAAGGTACATATACACCATGG - Intergenic
1046838709 8:118832257-118832279 GAAAATGTACATATACACCATGG + Intergenic
1046886157 8:119369510-119369532 GAAAATGTACATATACACCATGG + Intergenic
1047433311 8:124812232-124812254 GAAAATGTACATATATGCCATGG - Intergenic
1047592247 8:126338951-126338973 AAAGTTGTACATATACATCATGG - Intergenic
1048132751 8:131715934-131715956 GAAAAGGTACATATACGCCATGG + Intergenic
1048232104 8:132652574-132652596 CAAAATTCACATATACACCATGG + Intronic
1048241423 8:132745799-132745821 AAAATGGTACATATACACCATGG + Intronic
1048417721 8:134245011-134245033 GAAAATGTACATATACACCATGG - Intergenic
1048684601 8:136889988-136890010 AAATGTGTACATATACACCATGG - Intergenic
1048761410 8:137799475-137799497 GAAAATGTACATATACACCACGG - Intergenic
1048781307 8:138005418-138005440 CACAATGTTCATATACAGTATGG - Intergenic
1048907284 8:139100428-139100450 GAAAAGATACAGAAACAGCATGG - Intergenic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1050001180 9:1078306-1078328 GAAAAAGTACATCTATGGCAAGG + Intergenic
1050045708 9:1542675-1542697 GAAAATGTACATATACATCATGG - Intergenic
1050177505 9:2883570-2883592 AATATGGTACATATACAGCATGG - Intergenic
1050552981 9:6763588-6763610 GAAAATGCACATAAACACAAAGG - Intronic
1050764542 9:9115853-9115875 GAAAATGTATATACCCATCATGG + Intronic
1051216716 9:14805571-14805593 GAAGAGGTACATATCAAGCAAGG + Intronic
1051852461 9:21525544-21525566 GAAAATGTACATATACACCATGG - Intergenic
1052089296 9:24307783-24307805 GAAAATGTACATAAACTCAATGG + Intergenic
1052089385 9:24309062-24309084 AAATGTGTACATATACACCATGG - Intergenic
1052339295 9:27349540-27349562 GAAAATGTAAATAGTCAGTATGG - Intronic
1052567981 9:30182976-30182998 AAATGTGTACATATACACCATGG - Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052636815 9:31117059-31117081 GAAAATGTACATATACACCATGG - Intergenic
1052694714 9:31862686-31862708 GAAAATGTATATAAACACAATGG - Intergenic
1052768934 9:32669856-32669878 GAAAATGTACATACACACCATGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053558417 9:39162598-39162620 GAAAATGTACATATATACCATGG + Intronic
1053822532 9:41982823-41982845 GAAAATGTACATATATACCATGG + Intronic
1054138697 9:61456344-61456366 GAAAATGTACATATATACCATGG - Intergenic
1054608044 9:67204543-67204565 GAAAATGTACATATATACCATGG - Intergenic
1054715287 9:68551313-68551335 GTAATTCTACATATACAACAAGG - Intergenic
1054837308 9:69690694-69690716 GAAAATATACTTATTCATCACGG - Intergenic
1055322049 9:75091710-75091732 GAAAAAGTAAAGATAAAGCATGG + Intronic
1055387619 9:75780282-75780304 GAAAATGTACATATACACAATGG + Intergenic
1056009045 9:82306206-82306228 GAAAATGAAGATAAACAGCAGGG - Intergenic
1056376214 9:86014702-86014724 CAAAATCTACATCAACAGCATGG - Intronic
1056452825 9:86733325-86733347 GACAATGTACACATACAAGAAGG - Intergenic
1056510466 9:87299834-87299856 AAAAATGTATATATACACAATGG - Intergenic
1056527108 9:87453947-87453969 GAAAATGTACTAATACAGAGGGG - Intergenic
1056561956 9:87738339-87738361 AAAGTTGTACATATACATCATGG + Intergenic
1056562680 9:87746134-87746156 GAAAATATACATATACACAATGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057492845 9:95535733-95535755 GAAAATGTAAATAAAAACCACGG + Intergenic
1057644700 9:96862040-96862062 GAAAATGTACATATACACAATGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058341057 9:103897161-103897183 GAAATTGTTCATGTTCAGCAAGG - Intergenic
1058416316 9:104792660-104792682 CAAAATGTACATCTATACCAAGG - Intronic
1058516883 9:105785050-105785072 GAAAATGTACATATACACCATGG - Intergenic
1060266586 9:122115251-122115273 GAAAATGGTCATATCCAGAATGG - Intergenic
1060313171 9:122482641-122482663 GAAAATGTATATATACACAATGG + Intergenic
1060570239 9:124632029-124632051 GAAAATGTACATATACATCATGG - Intronic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1185702575 X:2242361-2242383 GAGAATGTACAAATACATCACGG + Intronic
1185749938 X:2602851-2602873 GAAATAGTACATATACACCATGG + Intergenic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1185939425 X:4298870-4298892 GAAAATGTGCATATCCACAACGG + Intergenic
1185939579 X:4300699-4300721 GAAAATGTGCATATCCACCATGG - Intergenic
1185967752 X:4626666-4626688 GAAAATGTATGTATACACCATGG - Intergenic
1186018735 X:5229295-5229317 ATATATGTACATATGCAGCAGGG + Intergenic
1186271238 X:7890657-7890679 AAGAAATTACATATACAGCATGG + Intergenic
1186912869 X:14187996-14188018 AATATTGTACATATACACCATGG - Intergenic
1186983423 X:14984269-14984291 GAAAATGTACCTATACACAATGG + Intergenic
1187144294 X:16623619-16623641 GAAAATGTACTTATACACAATGG - Intronic
1187586808 X:20671969-20671991 AAAAGATTACATATACAGCATGG - Intergenic
1187653645 X:21442782-21442804 GAAAATGTATATATACACCATGG + Intronic
1187756407 X:22531961-22531983 GAAAATGTACATATACACTGTGG + Intergenic
1188123796 X:26342786-26342808 GAAAATGTACATATTTACCATGG - Intergenic
1188287263 X:28343012-28343034 GAAAATGTACATATACACAACGG - Intergenic
1188289500 X:28370022-28370044 GAAAATGTACATACACACCACGG - Intergenic
1188295897 X:28447903-28447925 GAAAATGTACATATACACCATGG + Intergenic
1188676070 X:32941430-32941452 GAAAATCTAAATATACCCCATGG + Intronic
1188707008 X:33347121-33347143 GAAAATGTATATATACACCATGG + Intergenic
1188721731 X:33530315-33530337 GAAAATGTGCATATACACTGTGG - Intergenic
1188726768 X:33594170-33594192 GAAAATATAGATATAAAACAAGG + Intergenic
1188809722 X:34638335-34638357 GAAAATGAACACAAACAGTAGGG + Intronic
1189078789 X:37946790-37946812 GAAAATGTATATCTTCAGAAAGG - Intronic
1189132040 X:38509695-38509717 GAAAATGTACATATACACCATGG + Intronic
1189237603 X:39499762-39499784 GAAAATGTACATATACACCATGG - Intergenic
1189612281 X:42750138-42750160 GTAAATGTACTTATACACAATGG + Intergenic
1189842613 X:45096991-45097013 GAAAATGTATATATACACCATGG + Intronic
1190472033 X:50791845-50791867 CAGTATGTACATATAGAGCAAGG + Intronic
1190967465 X:55314233-55314255 GAAAATGTATAAATACACCATGG - Intergenic
1190972893 X:55369265-55369287 TAAAAGGTACATACACACCATGG - Intergenic
1191021496 X:55865747-55865769 AAAATGGTACATATACACCATGG + Intergenic
1191189015 X:57645978-57646000 GAAAATGTACATATACACATTGG + Intergenic
1191262934 X:58347680-58347702 CAAAATGTCCATTTACAGCATGG - Intergenic
1191268905 X:58436002-58436024 CCAAATGTACATTTGCAGCATGG + Intergenic
1191819662 X:65290634-65290656 GAAAATATACATATACACAATGG + Intergenic
1191845514 X:65544578-65544600 GCAAATGTACATAGAAAGTAAGG + Intergenic
1191878688 X:65822726-65822748 GAAAATGTACATATAAACCATGG + Intergenic
1191959188 X:66680810-66680832 AAATATGTACATAAACACCATGG - Intergenic
1192311516 X:70019526-70019548 GAAAATGTACATACATGTCATGG + Intronic
1192488112 X:71548547-71548569 GAAAATGTACATATATGCCATGG + Intronic
1192688896 X:73338294-73338316 GAAAATGTACATATACACAATGG + Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1192753717 X:74023157-74023179 GAAAACATACATGTACACCATGG + Intergenic
1192877053 X:75241703-75241725 GAAAACGTGCATATATATCATGG + Intergenic
1192944617 X:75951786-75951808 AAAAATGTACATATATGCCATGG - Intergenic
1192975568 X:76280498-76280520 GAAAATGTACATATACACAACGG - Intergenic
1193173417 X:78363332-78363354 AAATATGTAGATATACATCATGG + Intergenic
1193336916 X:80300716-80300738 GAAAATTTACGTATACACAATGG - Intergenic
1193371054 X:80697679-80697701 GAAAATGTACATAGACATCATGG - Intronic
1193378027 X:80784747-80784769 GAAAAGGTACATATACACCATGG - Intronic
1193504740 X:82328489-82328511 GAAAATATACATATACACCATGG + Intergenic
1193638220 X:83979426-83979448 GAAAATGTATATATACACCATGG + Intergenic
1193826491 X:86232971-86232993 GAAAATGTACATATACACCATGG + Intronic
1193889521 X:87027510-87027532 GAAAATGGACTAATACAGTATGG + Intergenic
1193891237 X:87048389-87048411 GAAAATGTACTTATACACAATGG - Intergenic
1193920236 X:87415931-87415953 GAAAATGTACATATACATCATGG - Intergenic
1194126833 X:90029053-90029075 TAAAATGGACTAATACAGCAAGG - Intergenic
1194137664 X:90166628-90166650 GAAAATGTACATATACACGATGG + Intergenic
1194391293 X:93321096-93321118 GAAAATGTACATATACACAATGG - Intergenic
1194406477 X:93502506-93502528 GAAATTGTGGATATACACCATGG + Intergenic
1194557343 X:95376710-95376732 AAAAATGTATATATACACCATGG + Intergenic
1194575172 X:95604135-95604157 GAACATGTACATAAACACAATGG + Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1194942769 X:100032250-100032272 GAAAATGTATGTATATACCATGG + Intergenic
1195039008 X:100996701-100996723 GAAAATTTACATTTCCAGCCTGG + Intergenic
1195252436 X:103062345-103062367 GTAAATATACATATACATCATGG - Intergenic
1195275818 X:103279133-103279155 AAAAATGTATATATCCAGCCTGG - Intergenic
1195279777 X:103320232-103320254 GAAAGTGTACGTATACACAATGG - Intergenic
1195471668 X:105237204-105237226 GAAAATGTGGGTATACACCATGG - Intronic
1195960520 X:110381702-110381724 GAAAATGTACACGTACACCATGG + Intronic
1196008519 X:110861380-110861402 GAAAATGTATATATACAAAATGG + Intergenic
1196151888 X:112383625-112383647 GAAAATATACATATATACTATGG + Intergenic
1196256200 X:113521983-113522005 GAAAATGTACATATATGCAATGG - Intergenic
1196354375 X:114772862-114772884 GAAAATGTAAAAATGCAGAATGG - Intronic
1196357133 X:114808328-114808350 GAAAATGTACACATACACAATGG - Intronic
1196464325 X:115957800-115957822 CAAAATGTACAAACAAAGCAAGG - Intergenic
1196532129 X:116800208-116800230 GATAATGAAAATATACAGAATGG - Intergenic
1196985930 X:121270914-121270936 GAAAATGTACACATACACCGTGG + Intergenic
1197228313 X:123975757-123975779 CAAAAAGTACATATTCCGCAGGG - Intronic
1197525112 X:127551642-127551664 GAAAATGCATATATACACAAAGG - Intergenic
1197564891 X:128070830-128070852 GAAAATGTAGATATACACCATGG - Intergenic
1197893910 X:131290655-131290677 GAAAATGTACATAAAAGGCTGGG - Intronic
1197950081 X:131885254-131885276 GAAAATACACATGTACACCATGG - Intergenic
1198501535 X:137254120-137254142 GAAAATGTACATACACAAGACGG + Intergenic
1199099146 X:143778745-143778767 GAAAATGTACATATACACAATGG + Intergenic
1199099725 X:143784992-143785014 AAACGTGTACATATACACCATGG + Intergenic
1199304636 X:146252947-146252969 GAAAATGTATATATACACAATGG + Intergenic
1199472930 X:148214795-148214817 CAAAATCTACAAATGCAGCAGGG + Intergenic
1199891931 X:152093260-152093282 GATAATATACATATAGAGAAGGG - Intergenic
1199945541 X:152663323-152663345 GAAAACATACATATACACCATGG - Intergenic
1200354013 X:155528692-155528714 GAAAATGTATATATACACCATGG - Intronic
1200483450 Y:3736896-3736918 GAAAATGTACATATACACGATGG + Intergenic
1200571276 Y:4832855-4832877 AAAACGGTACATATACACCATGG + Intergenic
1201012441 Y:9560901-9560923 GAAAATGAACTAATACAGGAGGG - Intergenic
1201189314 Y:11433032-11433054 CAAAATATACATATATAGGAAGG + Intergenic
1201228801 Y:11843996-11844018 GAAAAGGTCCATCTACATCAGGG + Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201612526 Y:15859399-15859421 GAAATGGTACATATATACCATGG + Intergenic
1201619095 Y:15935302-15935324 GAAAATGTGCATATACCCCAAGG - Intergenic
1201704609 Y:16922362-16922384 GAAAATGTACATATACACCCTGG - Intergenic
1201722911 Y:17121295-17121317 GAAAATGTGCATATTCACCATGG - Intergenic
1202297276 Y:23373019-23373041 GAAAATGTTTATATCCAGAATGG - Intergenic
1202573531 Y:26297578-26297600 GAAAATGTTTATATCCAGAATGG + Intergenic