ID: 1154262011

View in Genome Browser
Species Human (GRCh38)
Location 18:12843446-12843468
Sequence TGTACTCGGGATTGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154262011_1154262018 -9 Left 1154262011 18:12843446-12843468 CCCTCACCCCAATCCCGAGTACA 0: 1
1: 0
2: 1
3: 11
4: 151
Right 1154262018 18:12843460-12843482 CCGAGTACAGCTGACTGTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154262011 Original CRISPR TGTACTCGGGATTGGGGTGA GGG (reversed) Intronic
900925926 1:5705942-5705964 TGCAGTGGGGAGTGGGGTGAGGG - Intergenic
901631996 1:10652567-10652589 TTTTCTCTGGATTGGGGTGAGGG - Intronic
901775720 1:11559437-11559459 TGTACTGGGCACTGGGGTGCAGG + Intergenic
901871888 1:12143128-12143150 TGTACTCTGCACTGGTGTGAGGG + Exonic
903248470 1:22034450-22034472 TGTCCTGGGGGTGGGGGTGAGGG + Intergenic
903288070 1:22289485-22289507 TGTGCGCTGGATGGGGGTGACGG - Intergenic
904618358 1:31761725-31761747 TATACTGGGGGTTGGAGTGAAGG + Intronic
904650496 1:32002346-32002368 TTTACTAGGGACTGGGGTAAAGG - Intergenic
905647499 1:39634566-39634588 GGGACTGGGGCTTGGGGTGATGG - Intronic
907807715 1:57837926-57837948 GATACTGGGGATTGGGGTGATGG - Intronic
908547241 1:65173898-65173920 TGTATTAAGGTTTGGGGTGATGG + Intronic
909895027 1:81058052-81058074 TGCACTGGGGATTAGGGTGAGGG - Intergenic
910882038 1:91930370-91930392 TGCACAGGGGAGTGGGGTGATGG + Intergenic
914755571 1:150559916-150559938 TGTATTGGGGATTGGGGAGAGGG - Intronic
915304663 1:154970496-154970518 TGTACTTGGGCTTGGGGGGCAGG + Exonic
916507758 1:165443515-165443537 TGTACTTGGACTTGGGGTGAGGG - Intronic
917358701 1:174153783-174153805 TTTACTCTTGATTGTGGTGATGG + Intergenic
920118828 1:203640218-203640240 TGTTCTTGGGAGTGGGGTCAAGG - Intronic
921182699 1:212644274-212644296 TGTCCTTGGGGTTGGGGTGGGGG - Intergenic
1063407196 10:5807945-5807967 TGTAATCGGGGTTGGGGAGTGGG - Intronic
1065757759 10:28949717-28949739 TATGCTCTGGATTGGGGTTAGGG - Intergenic
1067834858 10:49632306-49632328 TGGCCTGGGGAGTGGGGTGATGG + Intronic
1068703799 10:60050127-60050149 TGTTCTCTGGGTTGGGGTGGGGG - Intronic
1068866007 10:61896675-61896697 TGTATTTGTGATTGGGGTGAGGG + Intergenic
1071286811 10:84156187-84156209 TGTGCTCGGTATCTGGGTGATGG + Intergenic
1073339100 10:102731679-102731701 TGGACTTGGGAAAGGGGTGATGG - Intronic
1077633124 11:3824434-3824456 TGTCCTCAGGATTCGGGTAATGG + Intronic
1077682693 11:4258997-4259019 TGTATTGGGGGTTGGGGAGAAGG - Intergenic
1081625547 11:44653249-44653271 TGTGCTCTGCAGTGGGGTGAGGG - Intergenic
1081643420 11:44773880-44773902 TGTACCCGTGCTTGGGGTTATGG + Intronic
1083490020 11:63009213-63009235 GGGACTGGGGATTGGGATGAAGG + Intronic
1084948314 11:72650857-72650879 TGTAGTGGGGACTGGGGTCAGGG - Intronic
1086192474 11:84095790-84095812 TGTAATGTGGATTGGGGAGAAGG + Intronic
1087614390 11:100471443-100471465 TGAACTAGGGATTGGGGTTGGGG - Intergenic
1088462211 11:110093436-110093458 TGTCCTCGGGAAGGGGGTGGGGG + Intronic
1088525095 11:110744392-110744414 TGCACTAGGGATTGGGGTGAGGG + Intergenic
1089234039 11:117007502-117007524 TGTACTCATGATAGAGGTGAAGG + Intronic
1089695439 11:120213284-120213306 GGTGCTGGGGATTGGAGTGAGGG + Intronic
1090051307 11:123382114-123382136 TTTTCTGGGGATTGGGGGGAAGG + Intergenic
1090294089 11:125570876-125570898 TGTTCTCAGGGTTGAGGTGAGGG - Intronic
1091670394 12:2448055-2448077 TGCACTTGGGATGGGGGTGTGGG + Intronic
1095040114 12:37432177-37432199 TGTACTGGGAACTGGTGTGAAGG - Intergenic
1096432379 12:51557363-51557385 TATACTAGGCATTGGGGAGAGGG + Intergenic
1098640486 12:72832963-72832985 TGTAGTAGGAATTGGGGTAATGG - Intergenic
1100182086 12:92096751-92096773 TGTACAGAGGAGTGGGGTGAAGG - Intronic
1101861231 12:108484010-108484032 TGGAGTGGGGCTTGGGGTGAGGG - Intergenic
1102360735 12:112285439-112285461 TGTGCTCTGGGTTGGGGTGCTGG - Intronic
1102470085 12:113154829-113154851 TGCTCTCGGGAGTGGGGTGCAGG - Intronic
1102798617 12:115711579-115711601 TGTAGTGGGGATGGTGGTGATGG - Intergenic
1103561259 12:121794258-121794280 TGCACGCGGGTTCGGGGTGAGGG + Exonic
1104657449 12:130584025-130584047 TGTAATGGTGATGGGGGTGATGG - Intronic
1107686233 13:42902174-42902196 GGAAGTTGGGATTGGGGTGAAGG - Intronic
1114763869 14:25348481-25348503 GGTAGTAGGGATTGGGGGGATGG + Intergenic
1115155326 14:30332375-30332397 GGCACTGGGGACTGGGGTGAAGG - Intergenic
1117175470 14:53141890-53141912 TGTATTTGGGGTTGGGGGGAAGG - Intronic
1119248111 14:73130380-73130402 TGTAGAAGGGATTGGGGTTAGGG + Intergenic
1121583656 14:95048441-95048463 GGTGCTCGGGATTGGGGTTTTGG - Intergenic
1122126130 14:99579650-99579672 TGGATTCGGGATTGAGGTGGGGG + Intronic
1124428994 15:29589882-29589904 TATACACGGGATTGTTGTGAGGG + Intergenic
1126800526 15:52293635-52293657 TGGACTGGGGAGTGGGGTGGGGG - Intronic
1127893248 15:63273149-63273171 TGGACTGTGGGTTGGGGTGATGG - Intergenic
1128064083 15:64753737-64753759 TGTGCCCGGGGTTGGGGTGATGG + Intronic
1131867272 15:96724435-96724457 TGTAGATGGCATTGGGGTGAAGG + Intergenic
1132827504 16:1912455-1912477 TGCACTGAGGATTAGGGTGACGG + Intronic
1132886788 16:2185679-2185701 TGTACTGGGGAGTGGGGGGCAGG + Intronic
1133205974 16:4233851-4233873 TGGACTCGGGTTAGGGATGAAGG - Intronic
1135960670 16:26992301-26992323 TGTGATCGGAATTGGGATGATGG - Intergenic
1136747667 16:32606179-32606201 TGAACTCGGGAATGGGTGGAAGG + Intergenic
1137967379 16:52949746-52949768 TGGGTTCGGGATTGGGGAGATGG - Intergenic
1141039392 16:80659034-80659056 TGTACTCACGATAGAGGTGATGG + Intronic
1141742810 16:85905327-85905349 TGAAGTAGGGAATGGGGTGAAGG - Intronic
1203049801 16_KI270728v1_random:865388-865410 TGAACTCGGGAATGGGTGGAAGG + Intergenic
1148289696 17:46433775-46433797 TAGAATCTGGATTGGGGTGAAGG + Intergenic
1148311864 17:46651347-46651369 TAGAATCTGGATTGGGGTGAAGG + Intronic
1151154946 17:72117799-72117821 AGTGCTCAGGATGGGGGTGAGGG - Intergenic
1152895344 17:82907701-82907723 TGTACTCGGGGTTAGGGTCTTGG + Intronic
1153770334 18:8410173-8410195 AGCACTCAGGATTGGGCTGAAGG - Intergenic
1154262011 18:12843446-12843468 TGTACTCGGGATTGGGGTGAGGG - Intronic
1161205147 19:3036867-3036889 TGTGGTCGGGGTTGGGGTTAGGG + Intronic
1161453061 19:4357421-4357443 TGTACGCGGGATGGGGCTGTGGG + Exonic
1162588851 19:11577782-11577804 AGGACACGGGATTGGGGTGGGGG + Intronic
1162748000 19:12810127-12810149 TTTTCCCGGGATTGAGGTGACGG + Exonic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1166976198 19:46606409-46606431 TGTACTTGAGATGGGGGTCAGGG - Intronic
926158628 2:10472619-10472641 TGACCACGGGCTTGGGGTGAAGG + Intergenic
926455384 2:13061098-13061120 TGTAGTGGGGGTAGGGGTGAGGG + Intergenic
928172892 2:29014717-29014739 TGCAGACGGGGTTGGGGTGAAGG + Intronic
929961857 2:46503046-46503068 GGGACTAGGGAGTGGGGTGAGGG - Intronic
930570246 2:53077385-53077407 TGAGCTAGGGATTGGGGTGGTGG - Intergenic
930745095 2:54874703-54874725 TTGACTGGGGGTTGGGGTGAGGG + Intronic
931230043 2:60366397-60366419 TGTCCTCAGGATGGGGGTGGGGG - Intergenic
933994147 2:87655532-87655554 TGTACAGGGAATTGGAGTGAAGG - Intergenic
936299718 2:111295381-111295403 TGTACAGGGAATTGGGGTGAAGG + Intergenic
941345160 2:164359522-164359544 TGGACACGGGAGTGGGGTGCGGG - Intergenic
942617284 2:177806328-177806350 GGTAGTTGGGATTGGGTTGAAGG + Intronic
948972922 2:241443193-241443215 TGCACTGGGGTTGGGGGTGAGGG + Intronic
1170568994 20:17622392-17622414 TGTGATGGGGATGGGGGTGAAGG + Intronic
1171534685 20:25876859-25876881 TGTACTGGGAACTGGTGTGAAGG - Intergenic
1171806395 20:29684061-29684083 TGTACTGGGAACTGGTGTGAAGG + Intergenic
1173834128 20:46113955-46113977 TGGACACGGGGTTGGGGTGGGGG + Intergenic
1177102866 21:16917481-16917503 TGTACAAGGGATTGGGGTTTGGG - Intergenic
1179168136 21:38951348-38951370 TGTGCTCAGGACTGGGCTGAAGG + Intergenic
1179385106 21:40934086-40934108 TCCACAGGGGATTGGGGTGAAGG - Intergenic
1179456561 21:41504854-41504876 TGGCCTCAGGATTGGGGTGCAGG - Intronic
1180574046 22:16756413-16756435 TGTACTGGGAACTGGTGTGAAGG - Intergenic
1182313713 22:29427714-29427736 TGGACTGGGGGTGGGGGTGAAGG + Intergenic
1183140739 22:35936290-35936312 GGAACTGGGGAATGGGGTGAAGG - Intronic
953414596 3:42708518-42708540 TGGAGCCGGGATGGGGGTGAGGG + Exonic
953996779 3:47525844-47525866 GGTGATCGGGATTGGGGTGGGGG + Intergenic
956223592 3:66931236-66931258 TGTATTAGAGATTGGGATGATGG - Intergenic
957331159 3:78766375-78766397 TGTACTGGGGGTTGGGGTTGGGG - Intronic
957487813 3:80885652-80885674 TGTACTAGAGATTGAGATGAAGG - Intergenic
957779727 3:84803263-84803285 TGTATTTTGGAGTGGGGTGAGGG + Intergenic
965478858 3:169191351-169191373 TGGACCAGGGATGGGGGTGAAGG + Intronic
966492560 3:180544442-180544464 TGTTCTCAGTATTTGGGTGATGG - Intergenic
966646661 3:182253139-182253161 TGTACTCAGGTATGGGGTGAGGG + Intergenic
967174827 3:186853516-186853538 TGTACTGGGAATAGGGATGAGGG - Intronic
973663018 4:53127412-53127434 TGTGCTGGGGGTTGGGGTGGGGG - Intronic
973862632 4:55080224-55080246 TGGAGTTGGGAATGGGGTGAGGG - Intronic
975330037 4:73102056-73102078 GCTACTGGGGATTGGGGGGATGG - Intronic
979751319 4:124282582-124282604 TGTACTTGGGCTAGGGATGAAGG + Intergenic
981108761 4:140911339-140911361 TGCAGTCGGCATTGGGCTGATGG + Exonic
981548178 4:145916003-145916025 TGTACAGGGGATTGGGGACATGG - Intronic
984010222 4:174361682-174361704 TATACTCAGTATTTGGGTGACGG + Intergenic
984582946 4:181531764-181531786 TGTACACGGGACTGGGGAAAGGG + Intergenic
988207073 5:28152326-28152348 GTTACTAGGGATTGGGGTGTGGG - Intergenic
991455501 5:66799297-66799319 TGTAACCTGGATTGGGGTGAGGG - Intronic
992687938 5:79216264-79216286 TGTACTCGGGGTTGGGTTACTGG + Intronic
997513175 5:134466698-134466720 TGTGCCTGGGATTGGGGCGAGGG + Intergenic
999093616 5:148958731-148958753 GGTACTGGGGATGTGGGTGAAGG - Intronic
1000325439 5:160168483-160168505 TTTTCTGGGGGTTGGGGTGAAGG + Intergenic
1001987857 5:176090914-176090936 TGAACTCGGGAATGGGTGGAAGG + Intronic
1002559100 5:180069407-180069429 TTTTCTCGGGGTGGGGGTGAGGG - Intronic
1004750234 6:18554912-18554934 TGTGCTCAGGACTGGGGTGTGGG + Intergenic
1009019671 6:57937181-57937203 TGAACTCGGGGATGGGCTGAAGG - Intergenic
1009748524 6:67852433-67852455 TGTAGTGGGGGGTGGGGTGAGGG + Intergenic
1020449536 7:8305593-8305615 TGCAGTCGGGATATGGGTGAGGG + Intergenic
1020865665 7:13558352-13558374 TGTAGATGGGATTGAGGTGATGG - Intergenic
1025286166 7:57663816-57663838 TGTACTGGGAACTGGTGTGAAGG - Intergenic
1026177031 7:68006974-68006996 TGGACATGAGATTGGGGTGAAGG - Intergenic
1029116608 7:98241015-98241037 TGTACTGGGGAGAAGGGTGAGGG - Intronic
1029230416 7:99063326-99063348 TGTACTCCAGCCTGGGGTGACGG - Intronic
1030305325 7:108012343-108012365 TGTATTTGGGATGGGGGTTAAGG + Intergenic
1032126852 7:129201590-129201612 GGTGCCAGGGATTGGGGTGAGGG - Intronic
1032591769 7:133198669-133198691 TGTATTGGGGATGGTGGTGATGG + Intergenic
1033591615 7:142813180-142813202 CATTCACGGGATTGGGGTGAGGG + Intergenic
1034078775 7:148257552-148257574 TGTTCTTGGGATTGGAGGGATGG + Intronic
1034458694 7:151186360-151186382 GGAACTGGGGGTTGGGGTGAGGG + Intronic
1034493049 7:151404560-151404582 GGTCCTCGGGGTTGGGGTGGGGG - Intronic
1037700549 8:21270111-21270133 TGTAGTTGGGAGTGGGGTCAGGG - Intergenic
1039836054 8:41257068-41257090 TGTACTTGGGAATGGATTGAGGG - Intergenic
1043184734 8:77133335-77133357 TGCACTCCGGCTTTGGGTGATGG - Intergenic
1043424686 8:80136773-80136795 TTTACACATGATTGGGGTGAAGG - Intronic
1046359129 8:113127507-113127529 GGTATTGGGGAATGGGGTGAGGG - Intronic
1046783129 8:118237071-118237093 TGTCCACAGGATTGGTGTGAGGG + Intronic
1048436506 8:134423400-134423422 TCTTCAGGGGATTGGGGTGAAGG + Intergenic
1053143977 9:35699543-35699565 TGCTCTAGGGATAGGGGTGAGGG - Intronic
1053300741 9:36947748-36947770 TGTGCTGGGGGTGGGGGTGATGG - Intronic
1058544742 9:106049034-106049056 TGTACTAGGTATTTGGGTGGAGG + Intergenic
1059822340 9:117987069-117987091 TGTACTCTGGTGTTGGGTGATGG - Intergenic
1191906598 X:66098977-66098999 TGTTCTGGGAATTGGGGGGAAGG - Intergenic
1200152944 X:153960134-153960156 TGTACTCGGGCTGGGGGTGGTGG + Exonic
1200329353 X:155280043-155280065 TGTACTTGGGACTCAGGTGAGGG + Exonic