ID: 1154266380

View in Genome Browser
Species Human (GRCh38)
Location 18:12883105-12883127
Sequence GAACACCGTGCCCCCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154266380 Original CRISPR GAACACCGTGCCCCCGGGGA GGG Intronic
900461931 1:2805787-2805809 GACCACCCAGCCCCAGGGGACGG + Intergenic
902361001 1:15942646-15942668 GAAGACCGTGCACCAGGGCAAGG - Exonic
902672581 1:17985085-17985107 GAACAGCCAGCCCCTGGGGACGG + Intergenic
905617056 1:39408745-39408767 GAACGCCCCGCCCCCGGAGAGGG - Intronic
906123523 1:43411519-43411541 GAACACCCTCCTCCCTGGGAAGG + Intronic
915595404 1:156893890-156893912 GACCACCCTGCCCCGGGGAAAGG + Intronic
924423633 1:243931617-243931639 GAGCCCGGTGCCCGCGGGGAGGG - Intergenic
1063700518 10:8380337-8380359 TAACACTGTGACCCCGAGGAGGG + Intergenic
1064007197 10:11708086-11708108 GAACACCCCGCACACGGGGAGGG + Intergenic
1073207160 10:101775441-101775463 GAACACCCAGCCGCCGAGGAAGG - Intronic
1078901935 11:15650276-15650298 GAGAACCGCGCCCCCGGGGTGGG + Intergenic
1086107076 11:83157710-83157732 GAACACTGTCCCCCTTGGGATGG - Intronic
1088344747 11:108810279-108810301 GAACTCTGGGCCCCAGGGGAGGG + Intronic
1089341517 11:117761208-117761230 GGACACCCAGCCCCCGGAGAAGG + Intronic
1089754331 11:120675222-120675244 GAGCACGGTGGCCCCTGGGAGGG + Intronic
1091231212 11:133989039-133989061 GAGCAGCGTCCCCCCGGGGCAGG + Intergenic
1091498353 12:991453-991475 GGGCAACGCGCCCCCGGGGAGGG + Intronic
1101736972 12:107470529-107470551 CCACACCGTGACCCTGGGGATGG - Intronic
1102968016 12:117143184-117143206 AAACACCGGACCCCCGGGGACGG + Intronic
1103901765 12:124307112-124307134 GATCACGATGCCCCCGCGGATGG - Intronic
1103953968 12:124566710-124566732 GAACACCGGCCCGCGGGGGAGGG + Intronic
1104481508 12:129111901-129111923 GACCTCCGTGCCACCAGGGATGG - Intronic
1104814840 12:131639679-131639701 AAACACCGAGCCTCCTGGGAGGG + Intergenic
1105332735 13:19433120-19433142 GAACAGCTTGCCCCAGGGAAAGG - Intronic
1105878953 13:24586659-24586681 GAACAGCTTGCCCCAGGGAAAGG + Intergenic
1105920885 13:24962391-24962413 GAACAGCTTGCCCCAGGGAAAGG - Intergenic
1106033395 13:26022726-26022748 GTCCACCCTGCCCCAGGGGAGGG - Exonic
1113738876 13:112697211-112697233 GCCCACCGTGGCCCTGGGGAAGG - Intronic
1115649243 14:35391061-35391083 GAACAACGTGCCTACAGGGAGGG + Intergenic
1117538617 14:56725222-56725244 GAACAGCCTGCCCCCTGGTATGG + Intronic
1123895800 15:24828880-24828902 GAGCAGCGTGGCCCAGGGGAGGG + Intronic
1131265135 15:90911196-90911218 GATCACCGTGCGCTCTGGGAGGG - Exonic
1132830147 16:1923954-1923976 GAACAGCGGGCCCTCGGGGAGGG - Intergenic
1136154681 16:28374815-28374837 GGACTCTGTGGCCCCGGGGAAGG - Intergenic
1136208411 16:28740443-28740465 GGACTCTGTGGCCCCGGGGAAGG + Intergenic
1141702923 16:85650661-85650683 GAACACGGTGCCGCCAGGGAAGG + Intronic
1142599765 17:1047917-1047939 GCCCACCGTGCCCACGGGGCTGG + Intronic
1142748098 17:1970598-1970620 GAACACAGTGTCAGCGGGGAAGG - Intronic
1143955279 17:10663366-10663388 GAACAAGGTGGCCCCAGGGAGGG + Intergenic
1149430878 17:56594777-56594799 GCACACCATGCCCTCGGGCACGG - Exonic
1152874926 17:82781181-82781203 GGACACCGTGCCCACGTGCAAGG - Intronic
1154266380 18:12883105-12883127 GAACACCGTGCCCCCGGGGAGGG + Intronic
1160046442 18:75391278-75391300 GGACTCCATGCCCCCGAGGAAGG - Intergenic
1160441506 18:78896308-78896330 GAACACCCTGCCCCTCTGGAGGG - Intergenic
1160832565 19:1110594-1110616 GAACACCGTGCATCCCGGGTGGG - Intronic
1160888418 19:1363495-1363517 GAGCACAGTGCCCTCGGGAAGGG + Intronic
1161210084 19:3061725-3061747 GAAGAGCGTGTCCCCGAGGAAGG - Intronic
1161703250 19:5805949-5805971 GGACACCGTGTCCCCGGCGGCGG - Intergenic
1162514954 19:11142345-11142367 GATCACCCTGCCCCTAGGGAGGG + Intronic
1162752707 19:12838619-12838641 GAACATACTGCCGCCGGGGAAGG - Exonic
1163128597 19:15258007-15258029 GAGCACAGCGCCCCCGGGGTAGG - Intronic
1164934779 19:32202066-32202088 GAAGACAGTGCCCATGGGGAGGG + Intergenic
1166315341 19:41986109-41986131 GAACATGGTGCCCCAGGTGAAGG - Exonic
1167410521 19:49341271-49341293 GAACACCCTCCTCCCAGGGAGGG - Exonic
925082602 2:1081788-1081810 GCACACAGTGCCCACAGGGATGG + Intronic
925365325 2:3307410-3307432 GAACACTGTGCCACTGAGGAAGG - Intronic
927513113 2:23656859-23656881 AAACACCGTGCAGGCGGGGAGGG - Intronic
928879530 2:36082375-36082397 GAACATGGTGCCCGCTGGGATGG - Intergenic
928879541 2:36082433-36082455 GAACATGGTGCCCGCTGGGATGG - Intergenic
932700296 2:73986737-73986759 GATCACCGTGCCCTCGAGGAAGG - Intronic
935101390 2:99999056-99999078 GCACACACTACCCCCGGGGAAGG + Intronic
937041264 2:118822404-118822426 GTACACAGTGCCCCAGGGAAGGG - Intergenic
937207426 2:120245712-120245734 CCACACCCTGCCCCGGGGGAGGG - Intronic
938263232 2:129909795-129909817 GAACACTGTGGACCCCGGGAAGG - Intergenic
947141699 2:227024859-227024881 GAACTCCGTTCCCACTGGGAAGG - Intronic
948722250 2:239908441-239908463 GAGCACCGTGCCCAGGGGCAGGG - Intronic
1176740287 21:10595422-10595444 GAACAGCTTGCCCCAGGGAAAGG + Intronic
1178487264 21:33026960-33026982 GGACACGGTGCCCCCAGTGAAGG - Exonic
1179218191 21:39385153-39385175 GAAAACAGTGCCCTCAGGGATGG + Intronic
1179287035 21:39986328-39986350 GAACACTGTGTCCTCGGGAAGGG - Intergenic
1179578568 21:42322969-42322991 CAACACCATGTTCCCGGGGATGG - Intergenic
1182515652 22:30857339-30857361 AAACACCGAGGCCCAGGGGAGGG + Intronic
1182669445 22:31983659-31983681 GAAAACCTTGCCCCGGGAGATGG + Intergenic
1185059903 22:48600948-48600970 GAGCACCGTGACCGCGGAGAGGG - Intronic
949875582 3:8624204-8624226 GAACAGGGAGCCCCAGGGGAGGG - Intronic
964115215 3:153129605-153129627 GAACGCCGTGGCGCCGGGGCGGG + Intergenic
967859044 3:194137956-194137978 GGGCGCCGCGCCCCCGGGGATGG - Exonic
968073260 3:195801430-195801452 GAGCCCCGGGGCCCCGGGGAGGG - Intronic
969375661 4:6761738-6761760 GAACACCGTGTCACCAGGGCCGG + Intergenic
977121128 4:93103283-93103305 TAACACTGTGCCCCAAGGGAAGG - Intronic
984947118 4:184978339-184978361 GAACACTGGGACCTCGGGGAGGG - Intergenic
985034050 4:185820607-185820629 GGACACCTTGCCTGCGGGGAAGG + Intronic
990253093 5:53937126-53937148 TGACACCGAGCCTCCGGGGACGG - Intronic
992571660 5:78065408-78065430 GACCACCGAGCTCCCGGGCAAGG + Intronic
996738411 5:126777520-126777542 GACCCCCGTGCCGCCGCGGATGG + Exonic
999175016 5:149625895-149625917 GAACAGCGTCACCCCTGGGAGGG - Intronic
1001409761 5:171502454-171502476 GAACACCGAGCCCCAGGGATGGG - Intergenic
1001535751 5:172496833-172496855 GAACAGTGTGCCCATGGGGAAGG + Intergenic
1010211947 6:73369199-73369221 GAACATCGTGCCCGAGGTGAGGG - Exonic
1015793660 6:136989389-136989411 GAACACGGTGCTGCAGGGGATGG + Intergenic
1020917332 7:14211028-14211050 GAACACCTTCACCCTGGGGAAGG - Intronic
1024475034 7:49800551-49800573 GAACACCCTGCCCCAGGGGAGGG - Intronic
1025255310 7:57380883-57380905 GTACTCAGTGCCCCCGGGAAGGG + Intergenic
1033450986 7:141462360-141462382 ATATACCGTGCCCCTGGGGATGG + Intronic
1037810351 8:22082899-22082921 GAGCACCCTGCCCCTTGGGAGGG - Intergenic
1048161489 8:132025565-132025587 TAACAGCCTGCCCCGGGGGAGGG + Intronic
1049726397 8:144148391-144148413 GACCACCGGGCTCCCGCGGAGGG - Intronic
1049726426 8:144148460-144148482 GACCACCGCGCTCCCGGGGAGGG - Intronic
1053173997 9:35909514-35909536 GAACGCCGTGGTCCCTGGGACGG + Intergenic
1055035847 9:71817588-71817610 GAACACAGTGAACCCGGGTAGGG + Intergenic
1058885705 9:109320270-109320292 GAACACGCTGCCCCCGGGCGCGG + Exonic
1060546929 9:124467443-124467465 GACAAACGTGCCCACGGGGAGGG - Intronic
1061561378 9:131406086-131406108 AACCCCCGGGCCCCCGGGGAGGG - Intronic
1062080466 9:134620869-134620891 GAACCCCGTGCCCCCGACAATGG + Intergenic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1199847306 X:151700720-151700742 GTACACCATGACCCGGGGGAGGG - Exonic
1200218917 X:154381057-154381079 GAAAACCGTGCTCCTGGGGCTGG + Exonic
1202598572 Y:26569296-26569318 GAACAGCTTGCCCCAGGGAAAGG + Intergenic