ID: 1154273104

View in Genome Browser
Species Human (GRCh38)
Location 18:12936859-12936881
Sequence TGAATTAGCACCCAAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154273104_1154273111 22 Left 1154273104 18:12936859-12936881 CCAGCCCCTTGGGTGCTAATTCA No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data
1154273104_1154273108 -3 Left 1154273104 18:12936859-12936881 CCAGCCCCTTGGGTGCTAATTCA No data
Right 1154273108 18:12936879-12936901 TCAGAGCATACACAACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154273104 Original CRISPR TGAATTAGCACCCAAGGGGC TGG (reversed) Intergenic
No off target data available for this crispr