ID: 1154273111

View in Genome Browser
Species Human (GRCh38)
Location 18:12936904-12936926
Sequence AATATTGCCCCAGCCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154273101_1154273111 25 Left 1154273101 18:12936856-12936878 CCCCCAGCCCCTTGGGTGCTAAT No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data
1154273103_1154273111 23 Left 1154273103 18:12936858-12936880 CCCAGCCCCTTGGGTGCTAATTC No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data
1154273107_1154273111 16 Left 1154273107 18:12936865-12936887 CCTTGGGTGCTAATTCAGAGCAT No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data
1154273102_1154273111 24 Left 1154273102 18:12936857-12936879 CCCCAGCCCCTTGGGTGCTAATT No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data
1154273105_1154273111 18 Left 1154273105 18:12936863-12936885 CCCCTTGGGTGCTAATTCAGAGC No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data
1154273104_1154273111 22 Left 1154273104 18:12936859-12936881 CCAGCCCCTTGGGTGCTAATTCA No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data
1154273106_1154273111 17 Left 1154273106 18:12936864-12936886 CCCTTGGGTGCTAATTCAGAGCA No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data
1154273100_1154273111 28 Left 1154273100 18:12936853-12936875 CCACCCCCAGCCCCTTGGGTGCT No data
Right 1154273111 18:12936904-12936926 AATATTGCCCCAGCCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154273111 Original CRISPR AATATTGCCCCAGCCCTGCA AGG Intergenic
No off target data available for this crispr