ID: 1154274076

View in Genome Browser
Species Human (GRCh38)
Location 18:12944853-12944875
Sequence CTGCTAGTACTGCTGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154274076_1154274082 12 Left 1154274076 18:12944853-12944875 CCTAGCTCCAGCAGTACTAGCAG No data
Right 1154274082 18:12944888-12944910 CCTCAGCTGTTCAGAGCTTGTGG No data
1154274076_1154274083 13 Left 1154274076 18:12944853-12944875 CCTAGCTCCAGCAGTACTAGCAG No data
Right 1154274083 18:12944889-12944911 CTCAGCTGTTCAGAGCTTGTGGG No data
1154274076_1154274084 22 Left 1154274076 18:12944853-12944875 CCTAGCTCCAGCAGTACTAGCAG No data
Right 1154274084 18:12944898-12944920 TCAGAGCTTGTGGGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154274076 Original CRISPR CTGCTAGTACTGCTGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr