ID: 1154274082

View in Genome Browser
Species Human (GRCh38)
Location 18:12944888-12944910
Sequence CCTCAGCTGTTCAGAGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154274078_1154274082 5 Left 1154274078 18:12944860-12944882 CCAGCAGTACTAGCAGAGGCTCC No data
Right 1154274082 18:12944888-12944910 CCTCAGCTGTTCAGAGCTTGTGG No data
1154274076_1154274082 12 Left 1154274076 18:12944853-12944875 CCTAGCTCCAGCAGTACTAGCAG No data
Right 1154274082 18:12944888-12944910 CCTCAGCTGTTCAGAGCTTGTGG No data
1154274075_1154274082 13 Left 1154274075 18:12944852-12944874 CCCTAGCTCCAGCAGTACTAGCA No data
Right 1154274082 18:12944888-12944910 CCTCAGCTGTTCAGAGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154274082 Original CRISPR CCTCAGCTGTTCAGAGCTTG TGG Intergenic
No off target data available for this crispr