ID: 1154274084

View in Genome Browser
Species Human (GRCh38)
Location 18:12944898-12944920
Sequence TCAGAGCTTGTGGGCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154274075_1154274084 23 Left 1154274075 18:12944852-12944874 CCCTAGCTCCAGCAGTACTAGCA No data
Right 1154274084 18:12944898-12944920 TCAGAGCTTGTGGGCTCCCATGG No data
1154274078_1154274084 15 Left 1154274078 18:12944860-12944882 CCAGCAGTACTAGCAGAGGCTCC No data
Right 1154274084 18:12944898-12944920 TCAGAGCTTGTGGGCTCCCATGG No data
1154274080_1154274084 -6 Left 1154274080 18:12944881-12944903 CCAGGAACCTCAGCTGTTCAGAG No data
Right 1154274084 18:12944898-12944920 TCAGAGCTTGTGGGCTCCCATGG No data
1154274076_1154274084 22 Left 1154274076 18:12944853-12944875 CCTAGCTCCAGCAGTACTAGCAG No data
Right 1154274084 18:12944898-12944920 TCAGAGCTTGTGGGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154274084 Original CRISPR TCAGAGCTTGTGGGCTCCCA TGG Intergenic
No off target data available for this crispr