ID: 1154276485

View in Genome Browser
Species Human (GRCh38)
Location 18:12965855-12965877
Sequence TACACTAGACAACCCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154276485 Original CRISPR TACACTAGACAACCCCAAGG TGG (reversed) Intronic
900895359 1:5479466-5479488 CACACTGTAAAACCCCAAGGAGG + Intergenic
904047496 1:27617226-27617248 TTCACCAGGCAACCCCCAGGGGG - Exonic
907679475 1:56550279-56550301 TACAGTAAACAACTCCTAGGTGG + Intronic
908873592 1:68643871-68643893 TAAATTAGACAATTCCAAGGAGG - Intergenic
923442735 1:234036812-234036834 TATACTACAAAACCCCAAGAAGG - Intronic
1065774853 10:29110165-29110187 TAAACTATTCAACCCCATGGAGG - Intergenic
1071106173 10:82098462-82098484 CTCACTACACCACCCCAAGGGGG - Intronic
1079326521 11:19497483-19497505 CACACTAGACCACTCTAAGGAGG - Intronic
1093558738 12:20511668-20511690 TACACTATACATCCTTAAGGAGG - Intronic
1100778347 12:97996859-97996881 TTGACAAGGCAACCCCAAGGTGG + Intergenic
1101645010 12:106623515-106623537 TAGACTAGAAAGCCCCAAGAAGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG + Intronic
1110739559 13:78978586-78978608 TACACATGACAACCAGAAGGTGG - Intergenic
1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG + Intergenic
1116305567 14:43250528-43250550 TACACTTAACTATCCCAAGGAGG + Intergenic
1135603282 16:23801571-23801593 GCCACCAGACAACCTCAAGGAGG - Intergenic
1138094801 16:54203190-54203212 AACACTAGACCACCCCATGAAGG + Intergenic
1138546949 16:57725415-57725437 GACACCAGACAACCCCAGGATGG - Intronic
1154276485 18:12965855-12965877 TACACTAGACAACCCCAAGGTGG - Intronic
1160937649 19:1604858-1604880 AACACCAGACAACCCTACGGAGG + Intronic
1167097003 19:47379919-47379941 TACGCCAGTCAGCCCCAAGGAGG + Exonic
926106019 2:10151796-10151818 TACACTAGACACCCACTCGGAGG - Intronic
927523754 2:23719322-23719344 TACATTAAACAACCCTAAGGAGG + Intergenic
946878718 2:224156718-224156740 TTCCCTTGACAACCCCAAAGAGG - Intergenic
947820975 2:233069205-233069227 TACTGTAAACAACCCCACGGAGG + Intronic
948080280 2:235200036-235200058 TAAACTAGACTACCCCTGGGTGG - Intergenic
948388254 2:237595019-237595041 TCCGCAAGAAAACCCCAAGGAGG - Exonic
1177165056 21:17591781-17591803 TCCCTTAGACAACTCCAAGGTGG - Intronic
950452778 3:13074538-13074560 TCCTCAAGACAACCCCAATGAGG + Intergenic
953372757 3:42404258-42404280 TTTATTAGACAACCCTAAGGAGG + Intronic
953954292 3:47218898-47218920 TTCAATAGACAACAACAAGGTGG - Intergenic
959903484 3:111685317-111685339 GACACTAGACAAACACGAGGGGG - Intronic
961409762 3:126711349-126711371 TTCACTAGGCAACCACATGGCGG - Intronic
972000278 4:34023033-34023055 TAGACTAGACAGCCCCGAGAAGG + Intergenic
972723995 4:41730128-41730150 TATACTAGAGAATCACAAGGTGG + Intergenic
975256649 4:72244428-72244450 TTCATTAGACAACACCAAAGTGG + Intergenic
978062046 4:104351055-104351077 GGCACTTGACAACCCCAAGGAGG - Intergenic
982359419 4:154503792-154503814 TATATTAGACTACCACAAGGGGG + Intergenic
994073941 5:95630347-95630369 CACACTATACAATACCAAGGGGG + Intergenic
1007220452 6:40274873-40274895 TACACTACACAACTCCAGGTAGG - Intergenic
1013864379 6:114677392-114677414 TAAACTAGGCAACCCCAGAGGGG - Intergenic
1017632509 6:156410847-156410869 TACACTAAACCACCACTAGGTGG - Intergenic
1022315320 7:29240136-29240158 TGCACTAGGGAAGCCCAAGGTGG - Intronic
1031308260 7:120161437-120161459 TAAACTAACCAAACCCAAGGAGG - Intergenic
1034850616 7:154489972-154489994 TACACAGGACAACCCAAAGAAGG + Intronic
1034993728 7:155565258-155565280 TACACTTGCCCACCCCAGGGTGG - Intergenic
1038166954 8:25094734-25094756 TTCACTAGAAGACCTCAAGGTGG + Intergenic
1040380185 8:46864928-46864950 TCCTCAAGACAAGCCCAAGGAGG + Intergenic
1044910385 8:97052028-97052050 AACACTAGAAATCCTCAAGGAGG - Intronic
1052289230 9:26823528-26823550 TAAACTAGCCAACCCCAAAGGGG - Intergenic
1056921794 9:90797387-90797409 TACAATATACAACACCAAGAGGG + Intergenic
1056921947 9:90798990-90799012 TACAATATACAACACCAAGAGGG - Intergenic
1058539998 9:106001934-106001956 TACATAAGACATACCCAAGGTGG + Intergenic
1191927345 X:66327869-66327891 TACACAATACATCCTCAAGGTGG + Intergenic
1195968401 X:110449699-110449721 AACACTAGGCAACCCCCAGGAGG + Intronic
1198534910 X:137575656-137575678 GACACTGGACAACCCCAAGAGGG - Intronic
1199088428 X:143661563-143661585 TGCACAAGGCAAGCCCAAGGAGG + Intergenic
1201631610 Y:16076568-16076590 TGCACTGCAAAACCCCAAGGAGG + Intergenic