ID: 1154281228

View in Genome Browser
Species Human (GRCh38)
Location 18:13005021-13005043
Sequence TTGTGGTACTAGAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154281228 Original CRISPR TTGTGGTACTAGAGGCAAGA GGG Intronic
900437448 1:2638143-2638165 CTGAGGTTCTAGAGGCAACAGGG - Intronic
902206408 1:14871319-14871341 TTGAGGAACAAGAGTCAAGAGGG + Intronic
906855615 1:49301339-49301361 TTGTGATGTTAGAAGCAAGATGG - Intronic
908594121 1:65667528-65667550 TTGTGGTCCTAGATGCTAAAGGG + Intergenic
911820658 1:102415680-102415702 TTGTCTTACAAGAGGAAAGAAGG + Intergenic
918209616 1:182339414-182339436 CTATGGTACTAGGGGCCAGAAGG - Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
919276820 1:195428858-195428880 TTGTGGGGTTAGAAGCAAGATGG + Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
923783697 1:237048047-237048069 CTGGGGTCCGAGAGGCAAGAGGG - Intronic
1064920641 10:20513534-20513556 TTATGGTCCTAGAGGCAAGAAGG + Intergenic
1064920723 10:20514938-20514960 TTATGGTCCTAGAGGCAAGAAGG - Intergenic
1069685209 10:70313535-70313557 TTGTGAGGCTAGAAGCAAGATGG - Intronic
1071880099 10:89888062-89888084 CTGTGATGCTAGAGGCAAGACGG - Intergenic
1072279453 10:93852610-93852632 TTGAGATATTAGAAGCAAGATGG - Intergenic
1074301350 10:112235749-112235771 TTGTGTTACAAGATGAAAGAGGG - Intergenic
1074454542 10:113585960-113585982 TTGTGGTAGGAGAGGCTAGCAGG + Intronic
1076316522 10:129545659-129545681 TGGTGGTCGTAGAGGCCAGACGG - Intronic
1076684240 10:132189915-132189937 TGGTGGTGCCAGAGGCAAGTCGG - Intronic
1077546098 11:3170700-3170722 TGGTGGTGCTGGAGGCAAGGAGG + Intergenic
1078736504 11:14025443-14025465 ATGACGAACTAGAGGCAAGATGG + Intronic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080554749 11:33406120-33406142 TTGTGTTACTAGAGTAAAAAAGG - Intergenic
1080995975 11:37602167-37602189 TGGGGGTGCAAGAGGCAAGATGG - Intergenic
1081303842 11:41486964-41486986 TTGTGGTAGTAGAGGCCTGTTGG - Intergenic
1085218802 11:74855096-74855118 TTGTGGGACAAAAGGCAATATGG - Intronic
1085363699 11:75917188-75917210 TTGTGAGGCTAGAAGCAAGATGG + Intronic
1086063474 11:82723516-82723538 ATGAGGTCCTAGAGGCAAGTGGG + Intergenic
1087721371 11:101669620-101669642 GTGGTGTTCTAGAGGCAAGAAGG - Intronic
1090171963 11:124613192-124613214 TGGTGGGGATAGAGGCAAGAGGG - Intronic
1095387171 12:41664564-41664586 TTGTGATCCTAGGGACAAGAAGG - Intergenic
1097354768 12:58588893-58588915 TTTTTGTAAAAGAGGCAAGAGGG - Intronic
1098094403 12:66939034-66939056 TTGAGGTATCAGAGGCAAGTTGG + Intergenic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1099866274 12:88286046-88286068 TTGTGGTACTAGAGTAGAGTTGG + Intergenic
1104305539 12:127607586-127607608 TAGTGGTGATAGAGGCCAGAGGG + Intergenic
1104340857 12:127947129-127947151 TTGTGAGGCTTGAGGCAAGATGG - Intergenic
1104693054 12:130840808-130840830 TGGTGGTGGCAGAGGCAAGAAGG - Intergenic
1105817210 13:24047513-24047535 TTGTGAGAATAGAAGCAAGATGG + Intronic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1110080989 13:71311557-71311579 TTGAGGAAGTAGAGCCAAGAAGG + Intergenic
1110400386 13:75083155-75083177 TTCTGGTCCTGGAGGCCAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1114539520 14:23444295-23444317 TAGGGATACTAGAGGCAAGAGGG - Intergenic
1116116902 14:40664582-40664604 TTGTCGTACTTTAGGCAAGCAGG - Intergenic
1116321668 14:43474711-43474733 TTGAAATACCAGAGGCAAGATGG + Intergenic
1116978545 14:51142705-51142727 ATGTGATACTAGAGGCAGGTTGG + Intergenic
1117968443 14:61229356-61229378 TTGGGGTAAAAAAGGCAAGAAGG + Intronic
1118291847 14:64533777-64533799 TTGTGGTATTAGAGGATGGAAGG - Intergenic
1119035170 14:71223626-71223648 TTTTGGTTCTGGAGTCAAGATGG - Intergenic
1120259031 14:82159320-82159342 CTATGATTCTAGAGGCAAGATGG - Intergenic
1128036491 15:64531162-64531184 TTGTGATATTATGGGCAAGATGG + Intronic
1128484012 15:68067166-68067188 TTGTGTTACGAGAGGCTAGTGGG + Intronic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1131479887 15:92771664-92771686 TTGTGGGGTTAGAAGCAAGATGG + Intronic
1131661814 15:94525260-94525282 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1131902186 15:97099897-97099919 TTGGGGCACTAGGGGCAAGCTGG - Intergenic
1131988057 15:98064993-98065015 GTGAGGTACAAGAGGCCAGAGGG - Intergenic
1137476361 16:48812772-48812794 GTGTGTTACTAGGAGCAAGAGGG + Intergenic
1138282635 16:55783786-55783808 TTCTGGGACTAGAGACAGGAGGG - Intergenic
1138933202 16:61687164-61687186 TTGTGGTATTACAGGAAAAAAGG - Intronic
1140134153 16:72190349-72190371 TCGTGAAGCTAGAGGCAAGATGG + Intergenic
1148862887 17:50613789-50613811 TTGTGGTACTCAAGGAAGGAAGG + Intronic
1149388446 17:56165884-56165906 TTGGGGCACTAGAGGTAAAAAGG - Intronic
1154281228 18:13005021-13005043 TTGTGGTACTAGAGGCAAGAGGG + Intronic
1157151231 18:45220804-45220826 TTGTGGTTCTCGAGGCTGGAAGG + Intronic
1157391798 18:47309345-47309367 TTGTAGTAATCCAGGCAAGAGGG + Intergenic
1159313152 18:66736502-66736524 TTGAGGTCCTAAAGGAAAGAAGG - Intergenic
1159580209 18:70227071-70227093 TTGTGCTATTGGAAGCAAGATGG - Intergenic
1159969638 18:74633587-74633609 TTGTAATACTAGAGGCCAAAAGG - Exonic
1165371695 19:35411639-35411661 GTGTGGTATTAAAGGGAAGAAGG - Intergenic
926752349 2:16208139-16208161 CTGTGATGCTAGAGACAAGATGG + Intergenic
927879095 2:26677878-26677900 TGGTGGTCCTAGAGGCAGGGTGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
930164091 2:48186792-48186814 TTGTGAGGCTAGAGACAAGATGG - Intergenic
931453027 2:62384478-62384500 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
932459073 2:71870845-71870867 TTCTGGTTAAAGAGGCAAGATGG + Intergenic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
932752627 2:74380947-74380969 TTGTGCTACAAGAAGAAAGAAGG - Intronic
933416303 2:81990988-81991010 TTGTGGGATTAGAAGCAAGGTGG - Intergenic
934784463 2:96995045-96995067 GTGTGGTTCTACAGGAAAGAGGG + Intronic
934852887 2:97712670-97712692 TTGGGGCACTAGAGGGGAGATGG + Intergenic
937508026 2:122559045-122559067 TTGTAGTAATAGAGACAAAAAGG + Intergenic
939328776 2:140730965-140730987 TAGTGCTGCTAGAGTCAAGATGG - Intronic
939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG + Intronic
939984258 2:148814562-148814584 TTGTGAGATTAGAAGCAAGACGG - Intergenic
941163033 2:162056549-162056571 TTGTGAGGTTAGAGGCAAGATGG - Intronic
941522041 2:166557538-166557560 TTGTGTTACTACAGGAATGAAGG - Intergenic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942480366 2:176381316-176381338 TTGTGGTACTTGAGGCACTGTGG + Intergenic
948884320 2:240875304-240875326 TTGGGGTTCTTGAGGCATGAAGG - Intronic
1168752397 20:292073-292095 TTGGGGTACAAAAGGAAAGAGGG - Intergenic
1169410774 20:5367899-5367921 TTGTGAGGTTAGAGGCAAGATGG + Intergenic
1170249339 20:14263129-14263151 TTTTGATACTAGAGGAAGGAAGG + Intronic
1171871292 20:30528247-30528269 TTGGGATACTAGAGGGAAGGAGG - Intergenic
1174585827 20:51607446-51607468 TTCTTGTTCTACAGGCAAGAAGG + Intronic
1176330438 21:5544857-5544879 TTCTGGTTCTAGAGACACGATGG - Intergenic
1176397319 21:6276094-6276116 TTCTGGTTCTAGAGACACGATGG + Intergenic
1176439838 21:6713010-6713032 TTCTGGTTCTAGAGACACGATGG - Intergenic
1176464100 21:7040079-7040101 TTCTGGTTCTAGAGACACGATGG - Intergenic
1176487661 21:7421858-7421880 TTCTGGTTCTAGAGACACGATGG - Intergenic
1180859795 22:19071215-19071237 TAGTGGTGCTGGAGGCAGGAGGG - Intronic
950551184 3:13666771-13666793 TTGTGGTCCTATAGCCAAGAGGG - Intergenic
951902067 3:27666743-27666765 TTGTGGTGGTAGAGGCAGGGAGG - Intergenic
955883974 3:63577907-63577929 TGCTGGTAATAGAGGCAAGGAGG + Intronic
956108005 3:65841954-65841976 TTTTGGTACTATAGACAAGAAGG + Intronic
957813932 3:85266589-85266611 TTATGAAACTAGAGTCAAGACGG + Intronic
959084651 3:101838492-101838514 TTGTGGGCCAAGAGACAAGATGG + Intronic
959605196 3:108234815-108234837 TTGATGTACTAGAGGCCAGATGG - Intergenic
959767079 3:110044439-110044461 TTCTGGTAATAGAAGCAAGGAGG - Intergenic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
964197736 3:154083959-154083981 GTGTGGAACTAAAGGCAACATGG - Intergenic
966424290 3:179764470-179764492 TTGTGGCCCTAGAGGAAAGAGGG + Intronic
968238823 3:197056243-197056265 TTATGGAGCTAGAGGGAAGATGG - Intronic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
977260411 4:94790434-94790456 TTGGGGTTCTGGAGGCAGGAAGG + Intronic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
978445696 4:108777960-108777982 TTGTGGGGCTAGAAGCAAGATGG + Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
980197920 4:129615010-129615032 TTGTGGTGCTAAAGGCAGCAGGG + Intergenic
980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG + Intergenic
984043785 4:174771872-174771894 TTGTGGTGAAAGAGGCAAAATGG + Intronic
984758646 4:183345567-183345589 TTGTGGGATTAGATGAAAGAAGG + Intergenic
984767201 4:183408801-183408823 ATGTGATCCTAGAGACAAGAAGG - Intergenic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985842521 5:2319229-2319251 TTGTTGCAATAGAGGCATGAGGG + Intergenic
986127183 5:4893998-4894020 GTGTGGCACAAGAGGAAAGAGGG + Intergenic
988850839 5:35179438-35179460 TTGTGGTAATAGATGCGACATGG + Intronic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
992588141 5:78262595-78262617 TTGTGGTACTGGAATAAAGACGG - Intronic
993475935 5:88364042-88364064 TTGTGGTACTTTAAGGAAGATGG - Intergenic
993652091 5:90534152-90534174 TTGTAGTAATTCAGGCAAGAGGG + Intronic
993813684 5:92514036-92514058 TTGTGATGTTAGAAGCAAGATGG + Intergenic
995225318 5:109693791-109693813 TTGGAGGACTAGAGGCAACAGGG + Intronic
995598932 5:113775512-113775534 CTGTGGTACTTGAGCCAGGAGGG + Intergenic
997828650 5:137130082-137130104 CTGTGAAGCTAGAGGCAAGATGG + Intronic
1003358299 6:5396772-5396794 TCTTGGTAGTAGTGGCAAGATGG + Intronic
1003819387 6:9878800-9878822 CTGTGGTGCTAGAAGCAATATGG - Intronic
1004675740 6:17840313-17840335 ATGTGATAATAGAGGCAAGTAGG + Intronic
1005817232 6:29563540-29563562 TACTGAAACTAGAGGCAAGAGGG + Intronic
1007503512 6:42316562-42316584 TTGTGAGGCTAGAGGCAAGATGG - Intronic
1008104387 6:47426754-47426776 TTGTGAAGCTAGAAGCAAGATGG - Intergenic
1016591876 6:145754941-145754963 TGGTGTTTTTAGAGGCAAGATGG + Intergenic
1020423037 7:8031356-8031378 TCGTGGAACTAGAGGATAGAAGG + Intronic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1022782328 7:33599028-33599050 TAGTGGTACCAGAGACCAGATGG + Intronic
1027540415 7:79457363-79457385 TCTTGCTACTAGAGGCAAGACGG - Intergenic
1027731419 7:81878444-81878466 TTGGGCAAATAGAGGCAAGAAGG + Intergenic
1033668085 7:143462523-143462545 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1035130689 7:156650451-156650473 GTGGGGTTCTAAAGGCAAGATGG + Intronic
1038646541 8:29366489-29366511 TTGTGAAACTGGGGGCAAGAGGG - Intergenic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1041497768 8:58505955-58505977 ATGAGGAAGTAGAGGCAAGAAGG + Intergenic
1044009425 8:86974380-86974402 CTGTGGTACTACAGGCATAAGGG - Intronic
1044023204 8:87133397-87133419 TTCTGCTACTACAGGAAAGATGG - Intronic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044906013 8:97003786-97003808 TTGTGGTAGGTGAGGCAGGATGG + Intronic
1046082800 8:109392858-109392880 TTGGGGTAATAGAGGAGAGAAGG - Intronic
1049513237 8:143040126-143040148 CTGTGGTGCTAGAGGCAGGGGGG + Intronic
1052603420 9:30669984-30670006 TTGTGGCTCTAGAGAGAAGAGGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057920087 9:99090155-99090177 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1058791808 9:108454474-108454496 CTGTGGGACAAGAAGCAAGATGG + Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1203777963 EBV:84710-84732 TTGTGGTACTGGTGGCAGTAGGG - Intergenic
1203431657 Un_GL000195v1:95469-95491 TTCTGGTTCTAGAGACACGATGG + Intergenic
1185644034 X:1604355-1604377 TTTTGGGACGAGAAGCAAGAGGG + Intergenic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186205406 X:7194680-7194702 TTGTGACATTAGAAGCAAGATGG + Intergenic
1186807336 X:13153382-13153404 TTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187044908 X:15637865-15637887 TTGTGGTGCTAGACTCAAGCTGG - Intronic
1189962842 X:46340812-46340834 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1191719797 X:64219992-64220014 GGGTGGTACAAGAGTCAAGAAGG + Intergenic
1192105278 X:68309851-68309873 TGGTGGTCCTAAAGGAAAGAAGG + Intronic
1196885157 X:120237371-120237393 TAGTGCTGCTAGAAGCAAGAGGG + Intergenic
1197267375 X:124389559-124389581 TTGTGATTCTAGAGGGAAAAAGG - Intronic
1199350139 X:146790630-146790652 TGGTGGTATTAGTGGCAAGCTGG - Intergenic
1199388183 X:147247696-147247718 TTAGGTTACTAGAGGCAAGATGG - Intergenic
1202043912 Y:20717576-20717598 TTTTGGTACTAGAGGGATGGTGG - Intergenic
1202298433 Y:23384578-23384600 TTTTGGGACTAGAGCCAAGATGG - Intergenic
1202572375 Y:26286021-26286043 TTTTGGGACTAGAGCCAAGATGG + Intergenic