ID: 1154282959

View in Genome Browser
Species Human (GRCh38)
Location 18:13024175-13024197
Sequence AGGTGTATACACGTTAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154282956_1154282959 1 Left 1154282956 18:13024151-13024173 CCTGTATTTTGATGCTGTCTTGT 0: 1
1: 0
2: 1
3: 25
4: 289
Right 1154282959 18:13024175-13024197 AGGTGTATACACGTTAAGGATGG 0: 1
1: 0
2: 0
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154282959 Original CRISPR AGGTGTATACACGTTAAGGA TGG Intronic
909444445 1:75732744-75732766 AGGTATATACATTTTAAAGAGGG + Intronic
910665008 1:89715332-89715354 AGGTGTAAACAAGTTAAAAATGG - Exonic
918706821 1:187673431-187673453 AGGTGCATCCACATTATGGAGGG + Intergenic
919575483 1:199303520-199303542 AGGTTTATACTTCTTAAGGATGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
924211954 1:241778185-241778207 AGGGACATACACATTAAGGATGG + Intronic
1062957022 10:1547185-1547207 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957050 10:1547334-1547356 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957144 10:1547809-1547831 AGGTGTATACACTGTGGGGAGGG + Intronic
1065807427 10:29407674-29407696 AGGTTTAAACAAGTTATGGAAGG + Intergenic
1065966871 10:30777903-30777925 ATGTGTAGACATGCTAAGGAGGG - Intergenic
1071178090 10:82950765-82950787 AGGTAGATACAGGTTAAGAAAGG + Intronic
1072006542 10:91255376-91255398 AGTTGTATGCATGTTCAGGAAGG + Intronic
1074650181 10:115513572-115513594 AAATGTATACCCCTTAAGGAGGG + Intronic
1074922257 10:118027220-118027242 AGGTGTAGAAAGGTTAAGTAAGG + Intronic
1075928123 10:126269956-126269978 AGTTGTATAGACGTTGAAGAAGG - Intronic
1078916407 11:15782801-15782823 ATGTGTCTACAGGTCAAGGAAGG + Intergenic
1085842597 11:80029530-80029552 AGCTGAATACAAGTCAAGGAAGG + Intergenic
1090155331 11:124431641-124431663 AGCTGTATACAGGGCAAGGAGGG + Intergenic
1095805104 12:46310747-46310769 AGGTGTATATATATTTAGGATGG + Intergenic
1097431738 12:59517316-59517338 AGATGTATACACGTTTAGAATGG - Intergenic
1100037893 12:90275780-90275802 AGGCCTATCCACGTTATGGAGGG + Intergenic
1100920821 12:99484675-99484697 AGGTGTATATATATTTAGGATGG + Intronic
1103071323 12:117945022-117945044 AAGTGTGTACACATTTAGGATGG - Intronic
1115021900 14:28692025-28692047 AGGTGTATATAGGGTAAGGTAGG - Intergenic
1121519577 14:94576892-94576914 AGGAGGAGACACATTAAGGAAGG - Intronic
1122146835 14:99695473-99695495 AGGTGTGTACACATTTAGGATGG + Intronic
1139417566 16:66826482-66826504 AAATATATTCACGTTAAGGAAGG - Intronic
1144019487 17:11227561-11227583 TGGTGCATAAAAGTTAAGGAAGG - Intergenic
1144099675 17:11932563-11932585 ATTCGTATGCACGTTAAGGAGGG + Intronic
1153124310 18:1772007-1772029 AGATGTAGACAGGTTAAGGAAGG + Intergenic
1153462726 18:5354309-5354331 ATGTGTATACAAGGTAACGATGG - Intergenic
1154282959 18:13024175-13024197 AGGTGTATACACGTTAAGGATGG + Intronic
1164308975 19:24029975-24029997 AGTTGTATACAAGTTAAGAAGGG + Intergenic
926869570 2:17398928-17398950 TGGTGGATACACCTTAAGGTAGG + Intergenic
928246896 2:29638333-29638355 AGGTGTATACTAGTCAATGAAGG - Intronic
928727408 2:34191204-34191226 TCGTGTATACAAGATAAGGAAGG - Intergenic
933360247 2:81272678-81272700 AAGTGTATAAACGTTTATGATGG - Intergenic
933674419 2:85041286-85041308 AAGTCAATACACGATAAGGAAGG + Intronic
939854183 2:147337505-147337527 AGGTGTACAAAAGGTAAGGAAGG + Intergenic
940494533 2:154408795-154408817 AAATGTATACAGGTTAAGAATGG + Intronic
942405531 2:175650005-175650027 AGGTGCATATACATTTAGGATGG - Intergenic
1169882414 20:10361523-10361545 AGGTGTAGACACGTTATAAATGG + Intergenic
1178330151 21:31682888-31682910 ATGTGTATGCAAGTTAAGAAGGG - Intronic
1178853924 21:36235417-36235439 AGGTTTAAACATGTGAAGGAAGG + Intronic
951593450 3:24291633-24291655 AGGTTTATACATGTTTAGTATGG + Intronic
953441398 3:42921338-42921360 AGGTTTAAACAAGTTATGGAAGG - Intronic
962966543 3:140359453-140359475 ATGTGTACACACATTAAGAAAGG + Intronic
965588232 3:170338502-170338524 AGGTTTAAACAAGTTATGGAAGG - Intergenic
972504083 4:39704848-39704870 AGGTGTATAGTCTTTAAGAAGGG - Intronic
973998753 4:56488099-56488121 ATGTGTATTCACTTTAAGGTAGG + Intronic
979540355 4:121873863-121873885 AGCTCTATGCACATTAAGGAAGG - Intergenic
982457582 4:155628609-155628631 AGGTGGATACACATTTAGGTTGG + Intergenic
983210350 4:164952086-164952108 GGGTTTATACACTGTAAGGATGG + Intergenic
984746018 4:183218821-183218843 AGGTATATTCACATTATGGAGGG + Intronic
986443762 5:7803430-7803452 AGGTCTATACCCGCTCAGGAGGG - Intronic
993023136 5:82616020-82616042 AGGTGTATACTCAGTAATGATGG - Intergenic
996737326 5:126770006-126770028 CGGTGTAGGCATGTTAAGGATGG - Intergenic
998292752 5:140930618-140930640 AGGTGTGTAGAAATTAAGGAAGG + Intronic
998773505 5:145572741-145572763 AGGTGTATACACATTAGTGCTGG + Intronic
999014593 5:148087373-148087395 AGGTGTGTACAGGCTAATGAGGG + Intronic
1001039632 5:168324938-168324960 AGGTGTCTACACATTTAGGATGG - Intronic
1004070408 6:12292158-12292180 AGGTGAACTCATGTTAAGGAGGG + Intronic
1007034861 6:38663888-38663910 AGGGGTACACACGCCAAGGATGG + Intergenic
1012962762 6:105639817-105639839 ATGTTTATACATGTTATGGATGG - Intergenic
1014972547 6:127835373-127835395 TGAAGTATACATGTTAAGGAAGG - Intronic
1016596218 6:145804473-145804495 ATGTGTATCCAAGTTAATGAGGG - Exonic
1016763768 6:147769358-147769380 AGGTGTATACACAAAAAGAAAGG - Intergenic
1019766186 7:2852567-2852589 AGGTGCATACAAGTTTAGAATGG - Intergenic
1019838284 7:3413081-3413103 AGGAGTATACTGGTTATGGAAGG + Intronic
1025854658 7:65266713-65266735 AGTTGTGTACAAGTTAAGAAGGG - Intergenic
1028812434 7:95102983-95103005 AGGCCAATCCACGTTAAGGAAGG - Intronic
1031342624 7:120622768-120622790 AGATGTATACAGGAAAAGGAAGG - Intronic
1038471932 8:27831375-27831397 AGGTACATACACATTTAGGATGG - Intronic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1043496848 8:80810884-80810906 AGGAGCATCCACGGTAAGGAGGG - Intronic
1043626309 8:82264193-82264215 ACGTGCTTACACATTAAGGATGG + Intergenic
1047831014 8:128629902-128629924 AGGTTTATACTAGTAAAGGACGG - Intergenic
1052681980 9:31704979-31705001 AGGTGTATAAAGCTTAAGAAAGG - Intergenic
1185809215 X:3089528-3089550 AGGTGTGTGCACGTGAAGAAAGG - Exonic
1187529579 X:20084299-20084321 AGGTGTATACACTGTGAAGAAGG - Intronic
1188889331 X:35590602-35590624 AGGTGTATAGACGCCAAAGAGGG - Intergenic
1190854074 X:54275993-54276015 TGGTGCATCCACGTTTAGGATGG - Intronic
1196098062 X:111820841-111820863 AAGTGTATCCTGGTTAAGGATGG + Intronic