ID: 1154293471

View in Genome Browser
Species Human (GRCh38)
Location 18:13130608-13130630
Sequence CTTCCCAGTATGACTTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154293466_1154293471 -6 Left 1154293466 18:13130591-13130613 CCAGGCCAGGCAGCCCTCTTCCC No data
Right 1154293471 18:13130608-13130630 CTTCCCAGTATGACTTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154293471 Original CRISPR CTTCCCAGTATGACTTAAGA GGG Intergenic
No off target data available for this crispr