ID: 1154295033

View in Genome Browser
Species Human (GRCh38)
Location 18:13140165-13140187
Sequence CCTGTTCACCAACCACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154295033_1154295039 13 Left 1154295033 18:13140165-13140187 CCTTCCAGTGGTTGGTGAACAGG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1154295039 18:13140201-13140223 CCCTCAACCTTTTGCTGACCTGG 0: 1
1: 1
2: 1
3: 19
4: 130
1154295033_1154295041 19 Left 1154295033 18:13140165-13140187 CCTTCCAGTGGTTGGTGAACAGG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1154295041 18:13140207-13140229 ACCTTTTGCTGACCTGGTGCAGG 0: 1
1: 1
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154295033 Original CRISPR CCTGTTCACCAACCACTGGA AGG (reversed) Intergenic
900431321 1:2604461-2604483 CCTGTGCCCGAGCCACTGGACGG + Intronic
902862685 1:19257486-19257508 CCTGTTCACCAACCGCACAAAGG + Exonic
902873662 1:19328576-19328598 CCTGTACACCAGGAACTGGATGG - Exonic
904478169 1:30777728-30777750 CTTGTTCACTGGCCACTGGATGG + Intergenic
905415904 1:37804048-37804070 CCTGCTCACCAGCCTCTGGTGGG - Intronic
906506607 1:46384412-46384434 CCTCTGCACCAACCCATGGATGG + Intergenic
907371389 1:54005746-54005768 CCTGTTCCCCACCCATAGGAGGG + Intergenic
916795513 1:168163439-168163461 CCTATTCAAAAACCACTGGGGGG - Intergenic
918076449 1:181174852-181174874 CCTGCTCCCCAACCACTGTCAGG - Intergenic
924359711 1:243225374-243225396 GCTATTCACCAAACACTGGAAGG + Intronic
1074124010 10:110514048-110514070 CCTGACCCCTAACCACTGGATGG + Intergenic
1075724019 10:124602675-124602697 CCTGGGCACCACCCACTGGAAGG + Intronic
1078408252 11:11089904-11089926 CCTATTCACCAGTCACTGGTTGG + Intergenic
1081009025 11:37784467-37784489 CCTATACACCAACCACAGGGAGG + Intergenic
1081699178 11:45141964-45141986 GATGTTCTCCAGCCACTGGAAGG + Intronic
1083367598 11:62150848-62150870 CCGGCTCAGCAACCACTGCAAGG - Intronic
1088531712 11:110817783-110817805 CTTGCTCACCAACAGCTGGATGG - Intergenic
1088731666 11:112689188-112689210 CCTGTCCCCCAAACACTGGCTGG - Intergenic
1088881675 11:113977823-113977845 CCTTTTGACCAACTACAGGAAGG + Exonic
1089357194 11:117861751-117861773 ATTGTCCTCCAACCACTGGAAGG + Intronic
1089698320 11:120229182-120229204 GCTCTTCACCAGCCACTAGAGGG + Exonic
1098293578 12:68981793-68981815 GCTCTCCACCAACCACTGCAAGG + Intergenic
1100598976 12:96096315-96096337 CCTGTTCACCAACCTGAGGTGGG + Intergenic
1101429530 12:104615440-104615462 GCTTTTCTCCAAACACTGGATGG - Intronic
1101583926 12:106067864-106067886 CCAGTTCACCCACCAGTGGTTGG + Exonic
1102199849 12:111049725-111049747 CATGGTCACCAAACCCTGGATGG + Intronic
1112179409 13:97062698-97062720 CCTATTAAACAACCACAGGAAGG + Intergenic
1112426298 13:99304342-99304364 CCTGTTCTCCATCCTCTGAAAGG + Intronic
1112643480 13:101304032-101304054 CTTGTTCATCAACCAATGCAGGG + Intronic
1112747062 13:102538434-102538456 CCTGGCTTCCAACCACTGGATGG + Intergenic
1118483850 14:66195645-66195667 CCTTTTCCCCCACCAGTGGAGGG - Intergenic
1119667454 14:76495329-76495351 CCTGTGCACCAACTGCAGGATGG - Intronic
1119855541 14:77897805-77897827 TCTGTTCACAAAGCACTGGGAGG - Intronic
1121264863 14:92594792-92594814 CATTTTCACCAACCACATGATGG + Intronic
1122609331 14:102970694-102970716 CCTGTGCCCAAACCACTCGAGGG + Intronic
1122912151 14:104836104-104836126 CCTGACCCCCAACCTCTGGAAGG - Intergenic
1128610303 15:69067622-69067644 CCTCTTCAGCACCCATTGGAGGG - Intergenic
1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG + Intronic
1128644568 15:69366344-69366366 CCTGTTCATCAACTAATGAATGG - Intronic
1131177943 15:90221517-90221539 CCTGTTCACCCAGCCCTAGAAGG + Intronic
1132398195 15:101489445-101489467 CGTCTACACCAACCACTGGGCGG - Exonic
1133439157 16:5806168-5806190 TTTCTTCACCAGCCACTGGAGGG + Intergenic
1135936825 16:26787639-26787661 CCTCTTCACCTACCACAGGGAGG + Intergenic
1137408745 16:48210094-48210116 CCAGGTCCTCAACCACTGGAAGG + Intronic
1137983815 16:53091219-53091241 GCTGTCAGCCAACCACTGGATGG - Intronic
1139799653 16:69511800-69511822 CCTGTTGACCAACATCTGGAAGG - Intergenic
1141891120 16:86927022-86927044 CCTGTCCACCTACCCCTGGATGG - Intergenic
1145002524 17:19315202-19315224 CCTGTTCACCAGCCAAAGGAGGG - Intronic
1145314479 17:21721231-21721253 CTTGCTCTCCAGCCACTGGAAGG + Intergenic
1146468290 17:33104454-33104476 CCTGTTTGAAAACCACTGGATGG - Intronic
1148749870 17:49939426-49939448 CCTGTTCACCAACCGCACAAAGG + Intergenic
1148859995 17:50599809-50599831 CCTGATGACCCCCCACTGGATGG + Exonic
1149400830 17:56294247-56294269 CTTGATTACCAGCCACTGGAGGG - Intronic
1149659074 17:58324998-58325020 CCTGTCCCCCAACCTCAGGAGGG - Exonic
1151452281 17:74205417-74205439 CCTGTACACCAACCACCGTCTGG - Intronic
1151765445 17:76131198-76131220 CCTGTTCCCCACCCCCTGAAGGG - Intergenic
1152342776 17:79734338-79734360 CCTGCTCACCAGCCGGTGGAAGG - Intronic
1153262492 18:3238126-3238148 CTTGTTCTCCTACAACTGGACGG + Intergenic
1154295033 18:13140165-13140187 CCTGTTCACCAACCACTGGAAGG - Intergenic
1156934619 18:42688647-42688669 CCTTTTCACAAACCAATGGCAGG - Intergenic
1157896904 18:51478196-51478218 CCTCTTCCACAACCAATGGAAGG - Intergenic
1158216236 18:55103392-55103414 CCATATCACCATCCACTGGAAGG - Intergenic
1159003680 18:62994143-62994165 CCTGTTCACTACCTTCTGGAGGG - Intergenic
1159745234 18:72225761-72225783 CCTGTGCAGCAACCACTAGCAGG + Intergenic
1162302168 19:9850198-9850220 CCTGTTCCCCCTCCACTTGATGG + Intergenic
1168478320 19:56694928-56694950 ACTGTTCCTCAACCTCTGGATGG - Intergenic
925814309 2:7732705-7732727 GCTGCCCACCATCCACTGGAGGG - Intergenic
927876208 2:26656942-26656964 CCTGGTCACCCTCCTCTGGATGG - Intergenic
936473273 2:112817339-112817361 CCCACTCCCCAACCACTGGAGGG - Intergenic
936872902 2:117154860-117154882 CCTCTTCATAAACAACTGGAGGG + Intergenic
940651568 2:156446046-156446068 CCCTTTCACCATCCACTGGCTGG - Intronic
941616345 2:167724941-167724963 CATGTTCTCCAAGCACTGAATGG - Intergenic
943614705 2:190079963-190079985 CCTGGTCACCAACAGCTGGCAGG - Intronic
943841981 2:192594989-192595011 CCTGCTACACAACCACTGGAGGG - Intergenic
945134177 2:206608710-206608732 CCTGCCCACCAAGCACTGGATGG + Intronic
948930269 2:241127405-241127427 CCTGTTCACCGTGCACTGGCAGG + Exonic
1171354732 20:24534975-24534997 TTTTGTCACCAACCACTGGATGG + Intronic
1173326360 20:42037291-42037313 GCTCTGCACCAACCACAGGATGG - Intergenic
1173837152 20:46133442-46133464 CCTGCTCGGCAACCATTGGAAGG - Intergenic
1174094064 20:48073921-48073943 CCTGACCTCCAACCACTGGCAGG - Intergenic
1174419425 20:50390014-50390036 TCTCTCCACCAACCACTGGGGGG - Intergenic
1175730989 20:61353764-61353786 CCAGTTCACCTTCCACTGGGTGG + Intronic
1176867708 21:14063183-14063205 CCTGCCCACCCACCACTGGAGGG - Intergenic
1181186199 22:21106224-21106246 CCTGTCCACCAACCAATGAAAGG - Intergenic
1182636727 22:31733613-31733635 CCTGTTCACCGAACACTTTAAGG - Intronic
1182756426 22:32683301-32683323 CCTGATCACCTACCCCAGGAAGG - Intronic
1183604669 22:38861363-38861385 CCTCTTCACCTGTCACTGGAGGG + Intergenic
950488931 3:13290327-13290349 CATGTTTACCAACCCCTGGAGGG + Intergenic
952957335 3:38565297-38565319 CCTGTTCTGTAACCACAGGAAGG + Intronic
953262855 3:41357047-41357069 CATCTTCTGCAACCACTGGAGGG + Intronic
957783277 3:84848141-84848163 CCTGATCCCCAACCATTGGGAGG + Intergenic
960371521 3:116846726-116846748 CTTGTTCACCTAACATTGGAAGG - Intronic
960907849 3:122619606-122619628 ACTGTTCATCAGCCACTGGGTGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961934553 3:130569563-130569585 TCTGTTCAACTCCCACTGGAAGG + Intronic
962809681 3:138949774-138949796 CCGGTTCACCCACCTCTGGCTGG - Intronic
963228601 3:142888339-142888361 ACTCTTCGCCAACCTCTGGAAGG - Intronic
963906814 3:150779617-150779639 CGTCTTCAACAACCACTGCAAGG - Intergenic
969327105 4:6450458-6450480 CAAGATCACCAAGCACTGGAAGG + Intronic
970394956 4:15655892-15655914 CTGGTTCACCAACCGCTGGGTGG - Intronic
972631877 4:40848977-40848999 CCTGTTCACTTACCACTGTCTGG + Intronic
975890603 4:79022700-79022722 CCAGTTCACCAAGCAGTGGCAGG - Intergenic
977451125 4:97199518-97199540 CCTCATCATCATCCACTGGAAGG - Intronic
981584642 4:146287663-146287685 CATGTTCTACAATCACTGGAGGG - Intronic
982330820 4:154180107-154180129 TATATTCACCATCCACTGGATGG + Intergenic
982483381 4:155938146-155938168 CCTGTGTATAAACCACTGGATGG - Intronic
984942597 4:184946844-184946866 TCTGATCTCCACCCACTGGATGG + Intergenic
985244963 4:187971176-187971198 CCTCTTCAGGAATCACTGGAAGG - Intergenic
985819635 5:2150947-2150969 GCTGTGCACAAACCACAGGACGG - Intergenic
991637945 5:68724920-68724942 CCAGGTCTCCCACCACTGGATGG - Intergenic
992063035 5:73076019-73076041 CCTGTTTTCTAAACACTGGAGGG - Intronic
999204294 5:149837043-149837065 CCTGGTCACCAGCCACTCGAAGG + Exonic
1001679879 5:173548648-173548670 ACTGTGCACCCAGCACTGGATGG - Intergenic
1002967629 6:1982568-1982590 CCTGTACACCAACCACACGCAGG + Intronic
1009338332 6:62522752-62522774 CTTGTTGAGCAACCACTTGAGGG - Intergenic
1009494155 6:64328261-64328283 ATTGTTCTCCAGCCACTGGAAGG - Intronic
1013783721 6:113756278-113756300 CCTGTTCACTCACCTCTGGAAGG + Intergenic
1015816242 6:137213986-137214008 CCTGCTCACCAACCTCTTCATGG + Intronic
1018246720 6:161830940-161830962 CCTGCTCCCCAACCACAGCAAGG + Intronic
1019374779 7:683608-683630 CATGTCCACCACCCACAGGATGG - Intronic
1019442916 7:1056431-1056453 CCTGCCCACCAGCCTCTGGATGG + Intronic
1029743233 7:102503062-102503084 CCTGCTCACCATCCGCTGGTGGG - Intronic
1029761222 7:102602223-102602245 CCTGCTCACCATCCGCTGGTGGG - Intronic
1032115866 7:129116611-129116633 CCTGTCCCCCACCCACTGGCAGG - Intergenic
1033969012 7:147014704-147014726 CCTTTCCACCAAACACTGGCAGG - Intronic
1046598772 8:116293421-116293443 TCTGTTTACCAAACACTGAATGG - Intergenic
1048333039 8:133484127-133484149 TCTGTTCACCACCCAGTGAATGG - Intronic
1048851564 8:138650224-138650246 CTTGTTCAGAAACCACTTGACGG - Intronic
1057564979 9:96159770-96159792 CCTCATCACCAGCCACTGGATGG + Intergenic
1058186759 9:101864226-101864248 CCTGGTTACCAATCACTGAATGG - Intergenic
1059416308 9:114164607-114164629 CCTGCTCAACAACCCCCGGAGGG - Intronic
1185752957 X:2628693-2628715 CCTGTACCCCATCAACTGGAAGG + Intergenic
1193070802 X:77303685-77303707 CCTGTTCTTCATCCCCTGGATGG - Intergenic
1198396251 X:136221863-136221885 CCTGTTCAACATCCACTGGCAGG + Intronic