ID: 1154295530

View in Genome Browser
Species Human (GRCh38)
Location 18:13143681-13143703
Sequence GGGTGCTGCAGCTGAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154295527_1154295530 7 Left 1154295527 18:13143651-13143673 CCAGTATTGGCAGGGAAGAAAGC No data
Right 1154295530 18:13143681-13143703 GGGTGCTGCAGCTGAAGAGATGG No data
1154295523_1154295530 23 Left 1154295523 18:13143635-13143657 CCAGTCATCAAGACAACCAGTAT No data
Right 1154295530 18:13143681-13143703 GGGTGCTGCAGCTGAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154295530 Original CRISPR GGGTGCTGCAGCTGAAGAGA TGG Intergenic
No off target data available for this crispr