ID: 1154299753

View in Genome Browser
Species Human (GRCh38)
Location 18:13182765-13182787
Sequence GTCCCCCTCTAGGCTCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154299753_1154299763 9 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299763 18:13182797-13182819 CACTGGCAGCTTCTGGGGCAGGG No data
1154299753_1154299757 -8 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299757 18:13182780-13182802 AGGGGGACACAGGAAACCACTGG No data
1154299753_1154299765 20 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299765 18:13182808-13182830 TCTGGGGCAGGGAGTGAGCTGGG No data
1154299753_1154299758 2 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299758 18:13182790-13182812 AGGAAACCACTGGCAGCTTCTGG No data
1154299753_1154299759 3 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299759 18:13182791-13182813 GGAAACCACTGGCAGCTTCTGGG No data
1154299753_1154299764 19 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299764 18:13182807-13182829 TTCTGGGGCAGGGAGTGAGCTGG No data
1154299753_1154299760 4 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299760 18:13182792-13182814 GAAACCACTGGCAGCTTCTGGGG No data
1154299753_1154299767 27 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299767 18:13182815-13182837 CAGGGAGTGAGCTGGGGACGAGG No data
1154299753_1154299766 21 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299766 18:13182809-13182831 CTGGGGCAGGGAGTGAGCTGGGG No data
1154299753_1154299762 8 Left 1154299753 18:13182765-13182787 CCCATCTGAGCCTAGAGGGGGAC No data
Right 1154299762 18:13182796-13182818 CCACTGGCAGCTTCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154299753 Original CRISPR GTCCCCCTCTAGGCTCAGAT GGG (reversed) Intergenic
No off target data available for this crispr