ID: 1154301906

View in Genome Browser
Species Human (GRCh38)
Location 18:13201464-13201486
Sequence ATAACCCAGCAGTTCCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154301903_1154301906 1 Left 1154301903 18:13201440-13201462 CCACACCAAGCATGCACATATCC No data
Right 1154301906 18:13201464-13201486 ATAACCCAGCAGTTCCACTTTGG No data
1154301901_1154301906 16 Left 1154301901 18:13201425-13201447 CCATTACTCAGCCAACCACACCA No data
Right 1154301906 18:13201464-13201486 ATAACCCAGCAGTTCCACTTTGG No data
1154301904_1154301906 -4 Left 1154301904 18:13201445-13201467 CCAAGCATGCACATATCCTATAA No data
Right 1154301906 18:13201464-13201486 ATAACCCAGCAGTTCCACTTTGG No data
1154301902_1154301906 5 Left 1154301902 18:13201436-13201458 CCAACCACACCAAGCATGCACAT No data
Right 1154301906 18:13201464-13201486 ATAACCCAGCAGTTCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154301906 Original CRISPR ATAACCCAGCAGTTCCACTT TGG Intergenic
No off target data available for this crispr