ID: 1154302811

View in Genome Browser
Species Human (GRCh38)
Location 18:13209246-13209268
Sequence TGTCCTTTGCAGGATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154302811_1154302814 13 Left 1154302811 18:13209246-13209268 CCATCCACATCCTGCAAAGGACA No data
Right 1154302814 18:13209282-13209304 TACAGCTGCACAGTATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154302811 Original CRISPR TGTCCTTTGCAGGATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr