ID: 1154302814

View in Genome Browser
Species Human (GRCh38)
Location 18:13209282-13209304
Sequence TACAGCTGCACAGTATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154302811_1154302814 13 Left 1154302811 18:13209246-13209268 CCATCCACATCCTGCAAAGGACA No data
Right 1154302814 18:13209282-13209304 TACAGCTGCACAGTATTCTGTGG No data
1154302809_1154302814 19 Left 1154302809 18:13209240-13209262 CCAGCTCCATCCACATCCTGCAA No data
Right 1154302814 18:13209282-13209304 TACAGCTGCACAGTATTCTGTGG No data
1154302812_1154302814 9 Left 1154302812 18:13209250-13209272 CCACATCCTGCAAAGGACATGAT No data
Right 1154302814 18:13209282-13209304 TACAGCTGCACAGTATTCTGTGG No data
1154302813_1154302814 3 Left 1154302813 18:13209256-13209278 CCTGCAAAGGACATGATCTCATT 0: 1859
1: 4096
2: 8504
3: 22208
4: 8614
Right 1154302814 18:13209282-13209304 TACAGCTGCACAGTATTCTGTGG No data
1154302808_1154302814 22 Left 1154302808 18:13209237-13209259 CCTCCAGCTCCATCCACATCCTG No data
Right 1154302814 18:13209282-13209304 TACAGCTGCACAGTATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154302814 Original CRISPR TACAGCTGCACAGTATTCTG TGG Intergenic
No off target data available for this crispr