ID: 1154303908

View in Genome Browser
Species Human (GRCh38)
Location 18:13217498-13217520
Sequence GGCCGCCGTGGCGGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 449}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154303908_1154303916 -5 Left 1154303908 18:13217498-13217520 CCTGAGCCCCCGCCACGGCGGCC 0: 1
1: 1
2: 2
3: 32
4: 449
Right 1154303916 18:13217516-13217538 CGGCCCCGGTACCCGCGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 203
1154303908_1154303929 25 Left 1154303908 18:13217498-13217520 CCTGAGCCCCCGCCACGGCGGCC 0: 1
1: 1
2: 2
3: 32
4: 449
Right 1154303929 18:13217546-13217568 CCGGGTCCCCACCGCGGAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 59
1154303908_1154303927 24 Left 1154303908 18:13217498-13217520 CCTGAGCCCCCGCCACGGCGGCC 0: 1
1: 1
2: 2
3: 32
4: 449
Right 1154303927 18:13217545-13217567 GCCGGGTCCCCACCGCGGAGTGG 0: 1
1: 0
2: 2
3: 7
4: 116
1154303908_1154303915 -10 Left 1154303908 18:13217498-13217520 CCTGAGCCCCCGCCACGGCGGCC 0: 1
1: 1
2: 2
3: 32
4: 449
Right 1154303915 18:13217511-13217533 CACGGCGGCCCCGGTACCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 85
1154303908_1154303921 6 Left 1154303908 18:13217498-13217520 CCTGAGCCCCCGCCACGGCGGCC 0: 1
1: 1
2: 2
3: 32
4: 449
Right 1154303921 18:13217527-13217549 CCCGCGGCCTGGCCGCGCGCCGG 0: 1
1: 0
2: 2
3: 38
4: 293
1154303908_1154303923 7 Left 1154303908 18:13217498-13217520 CCTGAGCCCCCGCCACGGCGGCC 0: 1
1: 1
2: 2
3: 32
4: 449
Right 1154303923 18:13217528-13217550 CCGCGGCCTGGCCGCGCGCCGGG 0: 1
1: 0
2: 4
3: 43
4: 306
1154303908_1154303930 29 Left 1154303908 18:13217498-13217520 CCTGAGCCCCCGCCACGGCGGCC 0: 1
1: 1
2: 2
3: 32
4: 449
Right 1154303930 18:13217550-13217572 GTCCCCACCGCGGAGTGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1154303908_1154303926 19 Left 1154303908 18:13217498-13217520 CCTGAGCCCCCGCCACGGCGGCC 0: 1
1: 1
2: 2
3: 32
4: 449
Right 1154303926 18:13217540-13217562 CGCGCGCCGGGTCCCCACCGCGG 0: 1
1: 0
2: 2
3: 13
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154303908 Original CRISPR GGCCGCCGTGGCGGGGGCTC AGG (reversed) Intronic
900091795 1:923996-924018 GGGCGGCGGGGCGGGGGCTTGGG + Intergenic
900283869 1:1890371-1890393 GGCGGCCCGCGCGGGGGCTCCGG + Intronic
900393516 1:2443886-2443908 GGCGGCGGGGGCGGGGGCTGCGG - Intronic
901540187 1:9910388-9910410 GGGCGCCGGGGCGGGGCCTGCGG + Intergenic
902332366 1:15736812-15736834 GGGAGCCGTGGCGGGGGCACTGG + Exonic
902351558 1:15859508-15859530 GGGCGTGGTGGCGGGGGCTGTGG - Intronic
902823243 1:18956241-18956263 GGCTGCCCTGGCGGGGGCGGCGG - Exonic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
903976774 1:27155096-27155118 TGCCGCCGGGGCCGGGGCTAGGG - Intronic
904485941 1:30824610-30824632 GCCCGCCCCGGCGGGGGCGCCGG - Intergenic
904824488 1:33265578-33265600 GGGTGCAGTGGCTGGGGCTCAGG + Intronic
905212774 1:36385856-36385878 GGCGGCGGCGGCGGCGGCTCGGG - Exonic
905221468 1:36450711-36450733 GGCCGCTGGCGCGGGGCCTCAGG + Intergenic
905731759 1:40303263-40303285 GGCCGCCATGGAGGAGACTCTGG + Intronic
905862645 1:41361513-41361535 GGCGGCGGCGGCGCGGGCTCCGG + Intergenic
906297670 1:44659102-44659124 GACCTCCGAGGCTGGGGCTCTGG - Intronic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
910759107 1:90718025-90718047 GGCCTCGGTGGCGGGGGCGCGGG - Intergenic
911116021 1:94247514-94247536 GGCCGCGGCGGTGGTGGCTCCGG - Intronic
912174687 1:107141236-107141258 TGCGGCGGTGGCGGCGGCTCGGG + Intronic
912486657 1:110034689-110034711 GGCGGAGGTGGCGGGGGCTGGGG - Exonic
912635244 1:111285854-111285876 GGCCGCTCTGGCAGGAGCTCTGG + Intergenic
914197331 1:145454417-145454439 GGCCGGCGGGGCGGGGGTCCCGG - Intergenic
914889759 1:151612259-151612281 GGCGGCGGCGGCGGGGGGTCTGG + Exonic
915313892 1:155017544-155017566 GGCAGCGGTGGCGGCGGCTCCGG - Exonic
915325322 1:155078917-155078939 GGCGGCGGCGGCGGCGGCTCCGG + Exonic
916064416 1:161124454-161124476 GCCCGCCATGCTGGGGGCTCAGG + Exonic
916890368 1:169107027-169107049 GGCCGGGGTGGCGGGGGCGAGGG + Intronic
917962295 1:180154766-180154788 GGCCTCGGGGGCGGGGGCTCGGG + Intergenic
917962303 1:180154780-180154802 GGGCTCGGGGGCGGGGGCTCAGG + Intergenic
918114177 1:181482888-181482910 GGCGGCGGTGGCGAGCGCTCCGG + Intronic
922739367 1:228006872-228006894 GCCCGCCGGGGCCGGGGCCCGGG - Intergenic
922950969 1:229558420-229558442 GGCTGCCGGGGCGGGGGTCCGGG - Exonic
923494555 1:234513038-234513060 GGCCGGCTTTGCGGGGGCTCTGG - Intergenic
924415209 1:243850443-243850465 CGCCGGCGGGGCGGCGGCTCTGG + Intronic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1063178289 10:3571495-3571517 GGCCACCTGGGCGGGCGCTCCGG - Intergenic
1063965143 10:11340647-11340669 GGCCTGAGAGGCGGGGGCTCTGG + Intergenic
1064209083 10:13348120-13348142 GGCGGCGGCGGCGGGGGCCCGGG + Exonic
1065186522 10:23174604-23174626 GGCCGGCGGGGCGGGGGCGGGGG - Intergenic
1067312467 10:45126984-45127006 GGAGGCCGAGGCGGGTGCTCTGG + Intergenic
1069456956 10:68560989-68561011 CGGCGCTGTGGCGGGGCCTCCGG - Intronic
1070032617 10:72692200-72692222 GGCGGCGGCGGCGGGGGCGCCGG + Exonic
1070327746 10:75399483-75399505 GGCGGCCGCGGCCGGGTCTCTGG - Exonic
1070570627 10:77637654-77637676 GGCAGCCGGCGCAGGGGCTCGGG + Intronic
1072102167 10:92239637-92239659 GGCCGACGAGGCGGCGGCTGCGG + Exonic
1072735358 10:97875566-97875588 GGCCCCTGTGGCTGGGGTTCTGG + Intronic
1075697481 10:124447613-124447635 GGCGGCGGCGGCGGCGGCTCGGG - Exonic
1076373892 10:129971318-129971340 GGCAGCCGTGGCGGCGGGCCTGG + Intergenic
1076373896 10:129971330-129971352 GGCGGGCCTGGCGCGGGCTCCGG + Intergenic
1076792881 10:132786112-132786134 GGCGGCGGCGGCGGCGGCTCCGG + Intergenic
1076831530 10:132996725-132996747 GGCTGCTGTGGCGGGAGCTGTGG + Intergenic
1076878848 10:133230385-133230407 GGCCTCCGGGGCGGGGTCCCCGG - Exonic
1077048287 11:555613-555635 GGCGGCCGGGGCGGGGCCTGGGG + Intronic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1077332622 11:1990101-1990123 GGCGTGCGTGGCGGGGGCCCTGG - Intergenic
1077336065 11:2005163-2005185 GGGCACCTTGGCTGGGGCTCTGG - Intergenic
1077514210 11:2992064-2992086 GGCGGCCGCGGCGGGGCCTGGGG - Intronic
1077923092 11:6655862-6655884 GGGCGGAGGGGCGGGGGCTCGGG - Intergenic
1080503804 11:32893253-32893275 GGCGGCGGCGGCGGCGGCTCGGG - Exonic
1081812802 11:45922860-45922882 GGCCGCCGACGGGGGCGCTCAGG - Exonic
1082029508 11:47594271-47594293 GGCAGGGGCGGCGGGGGCTCCGG + Exonic
1083161992 11:60860034-60860056 GGCAGCCCTGGCCTGGGCTCAGG + Intergenic
1083253118 11:61481227-61481249 GGCCGCTGTGGTTGGGCCTCGGG + Intronic
1083316301 11:61816719-61816741 GGCCGCCGAGACCGCGGCTCAGG - Exonic
1083572591 11:63768446-63768468 GGCGGCCCGGGCGGGGGCCCCGG - Intronic
1084128764 11:67118437-67118459 GGGCCCCGTGGCGGCGGCGCCGG + Intergenic
1084174765 11:67417473-67417495 GGCCCCTGGGGAGGGGGCTCTGG + Exonic
1084284168 11:68120948-68120970 GGCTGCGGCGGCGGGGGCTGGGG + Exonic
1085044016 11:73343110-73343132 AGCCGCTGGGGCGGGGGCGCCGG - Intronic
1086561629 11:88175490-88175512 GGGCGGCGGGGCGGGGGCTGGGG + Intergenic
1086724670 11:90167420-90167442 AGCGGCCGCGGCGGGGGCGCAGG - Intronic
1087634544 11:100687592-100687614 GGCGGCCGCGGCGGGCGCTGGGG - Intergenic
1090839674 11:130477095-130477117 GGCCGCTGGGGCGGGGTTTCAGG + Intergenic
1202815605 11_KI270721v1_random:45277-45299 GGCGTGCGTGGCGGGGGCCCTGG - Intergenic
1202819049 11_KI270721v1_random:60345-60367 GGGCACCTTGGCTGGGGCTCTGG - Intergenic
1091594988 12:1872241-1872263 GGCCTCCGTGCAGGGGGCTCTGG - Intronic
1092441550 12:8509152-8509174 GGCAGCTGTGCTGGGGGCTCAGG + Intergenic
1093303238 12:17479182-17479204 GGCCCCAGTGGTGTGGGCTCAGG - Intergenic
1095953076 12:47791883-47791905 GGCTGCAGGAGCGGGGGCTCCGG - Exonic
1096073565 12:48788930-48788952 GGGCGGCGGGGCGGGGGCCCAGG - Intronic
1096106335 12:48998622-48998644 GGCCGGCGGGGCGGCGGCTGTGG + Exonic
1096389483 12:51217731-51217753 GGCCGCCGTGGCCCCGGCCCCGG - Intergenic
1096595278 12:52691253-52691275 GGCGGCGGTGGCGGGAGCTACGG - Exonic
1096598696 12:52714470-52714492 GGCCGCAGCGGCTGGGGCTTGGG - Intergenic
1097889115 12:64759475-64759497 GGCCGGCGTGGGCGGGGCTGCGG + Intergenic
1098781613 12:74694209-74694231 GGTGGCGGTGGCGGTGGCTCAGG - Intergenic
1101144750 12:101830709-101830731 GGCGGCGGCGGCGGCGGCTCAGG - Exonic
1101605953 12:106247852-106247874 GGCGGGCGCGGCGGCGGCTCGGG + Exonic
1101781553 12:107843335-107843357 GGACGCCTTGGAGGGGGCGCTGG - Intergenic
1101970454 12:109309138-109309160 GGCCGCCGCTGCCGGCGCTCCGG + Exonic
1102238681 12:111310332-111310354 GGCCGGGGTGGCAGGGGCTGTGG - Exonic
1102247153 12:111362805-111362827 GGCGGTGGTGGAGGGGGCTCGGG + Exonic
1102933861 12:116881280-116881302 GGCCGCGGTGCAGGGGGCACGGG + Exonic
1104078726 12:125412000-125412022 GGGTGCCGTGGCAGGGGCTGAGG - Intronic
1104112482 12:125716930-125716952 GGCCCCTGTGGCTGGGGCGCAGG + Intergenic
1104444711 12:128823859-128823881 GGCGGCCGCGGCGGCGGCTGGGG - Exonic
1104602451 12:130162675-130162697 GGCCGCTGCGCCGGGAGCTCCGG + Exonic
1104858778 12:131914099-131914121 GGCCACCCTGGCCGGGGCCCTGG - Intronic
1104927633 12:132321931-132321953 GGGGGCCGAGGCGGGGGCTGGGG - Intronic
1104927647 12:132321961-132321983 GGGGGCCGAGGCGGGGGCTGGGG - Intronic
1106719931 13:32427323-32427345 GGCGGCCGTGGCAGTGGCCCGGG - Intronic
1108046112 13:46386578-46386600 GTCCGGCGTGGCGGGGGGTTGGG + Intronic
1108240365 13:48457665-48457687 GGAAGCCGAGGCGGGGGCTGAGG - Intronic
1108648802 13:52455632-52455654 GGCCGCGGTGGCGGTGGCGGTGG + Intronic
1110484045 13:76017186-76017208 GGCCAGCGTGGCTGGGGCTATGG - Intergenic
1111964448 13:94846838-94846860 GGCCACTGTGGCGGGGGTTGGGG + Intergenic
1112007006 13:95262200-95262222 GGCCCACGTGGCTGGGGCCCTGG + Intronic
1112216351 13:97434383-97434405 GGCCGCCGGGGCCGGGGCTGGGG + Exonic
1114194026 14:20461386-20461408 GGCGGCGGTGGCGGTGGCTGCGG - Exonic
1114312016 14:21476685-21476707 GGCGGCCGGGGGCGGGGCTCGGG - Intronic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1116928617 14:50668075-50668097 GGCGGCGGAGGCGGCGGCTCGGG - Exonic
1119709650 14:76812602-76812624 GGCCCGCGGGGCAGGGGCTCAGG + Intronic
1121417424 14:93788779-93788801 GGCCGCCGAGGCGGAGGCAGAGG + Intergenic
1122130917 14:99604244-99604266 GGGCGGGGCGGCGGGGGCTCCGG - Intergenic
1122162194 14:99793046-99793068 GGCGGCCCTTGCGGGGGCGCGGG - Intronic
1122270761 14:100567676-100567698 GGCCGCTGCGGCGGGGGCTGGGG - Intronic
1122291931 14:100685601-100685623 GGCTGCGGTGGAGGGGGCTGAGG - Intergenic
1122291966 14:100685691-100685713 GGCTGCGGTGGAGGGGGCTGCGG - Intergenic
1122292030 14:100685862-100685884 GGCTGCGGTGGAGGGGGCTGAGG - Intergenic
1122292036 14:100685877-100685899 GGCTGCGGTGGAGGGGGCTGCGG - Intergenic
1122292088 14:100686016-100686038 GGCTGCGGTGGAGGGGGCTGAGG - Intergenic
1122292094 14:100686031-100686053 GGCTGCGGTGGAGGGGGCTGCGG - Intergenic
1122292112 14:100686078-100686100 GGCTGCGGTGGAGGGGGCTGAGG - Intergenic
1122292147 14:100686169-100686191 GGCTGCGGTGGAGGGGGCTGCGG - Intergenic
1122292164 14:100686213-100686235 GGCTGCGGTGGAGGGGGCTGCGG - Intergenic
1122542768 14:102507227-102507249 GGGAGCTGAGGCGGGGGCTCCGG + Exonic
1122603028 14:102930570-102930592 AGCCGCCGCGGCAGGGGCTGCGG - Exonic
1122609759 14:102973845-102973867 GGCAGGCGTGGCAGGGGCCCCGG + Intronic
1122656083 14:103260309-103260331 GGCCCTCGTGCCTGGGGCTCAGG + Intergenic
1123017946 14:105384481-105384503 TCCCGCCGTGGCGTGGGCTGTGG - Intronic
1124340308 15:28886000-28886022 AGCGGCCGGGGCGGGGGCGCAGG + Exonic
1124453613 15:29821774-29821796 GGCGGCCGGGGAGGGGGCTGCGG - Intronic
1124589057 15:31036971-31036993 GGCCTGCCTGGCGGGGGCTGTGG + Intronic
1125999255 15:44194571-44194593 GGCCGCCCCGTCGGGGGCGCAGG - Intronic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1128028579 15:64460600-64460622 GGCGGCGGTGGCGGCGGCTGAGG + Intergenic
1128092547 15:64928777-64928799 GGCAGCCTTGGCGTGGGCCCGGG - Intronic
1128455032 15:67827370-67827392 GGCAGCCGTGGCGGCGGCAGCGG + Intronic
1128987541 15:72231757-72231779 GGCCGCCTTCGGAGGGGCTCTGG + Intronic
1129108197 15:73323091-73323113 GGCTGCCGTGGGGGTGTCTCTGG + Exonic
1129483157 15:75843581-75843603 CGCGGCCGTGACGGCGGCTCCGG + Exonic
1129517648 15:76166349-76166371 GGCCGCTGTGGAGAGGGCTTGGG - Intronic
1130099369 15:80880786-80880808 GGTGGCCGTGGTGGGGGGTCAGG + Intronic
1130115628 15:81002190-81002212 GGCCGCCGGGGCGGCGGCAGTGG + Exonic
1130531108 15:84748483-84748505 GGCTGCCGCGGCGGGGGATTGGG - Intergenic
1132398007 15:101488885-101488907 GGCCGCCTTGGCGCGCGCACCGG + Intronic
1132581054 16:684814-684836 GGCCGCCGTGGCTGCAGCCCTGG + Exonic
1132726458 16:1341021-1341043 TGCCTGCGTGGCGGGGGCACGGG + Intronic
1133051604 16:3120277-3120299 GGCGGCGGCGGCGGGGGCTCTGG + Exonic
1133113411 16:3563052-3563074 GGACGCCCTGGCTGAGGCTCAGG + Exonic
1133156604 16:3880555-3880577 GGCCGCCGGGGCGGGCGCCGAGG + Exonic
1133273853 16:4625106-4625128 GGGCGCGGGGGCGGGGACTCGGG + Intronic
1135047680 16:19168379-19168401 GGAGGCCGAGGCGGGGGCCCTGG + Exonic
1135517710 16:23149313-23149335 GGCGGCCGTGGCGGGGCCGCGGG - Intergenic
1135565844 16:23510381-23510403 GACCGCGGTGGCGGCGGCTGTGG - Exonic
1135763483 16:25156599-25156621 GGCCAGTGTGGCTGGGGCTCGGG + Intronic
1136453939 16:30370069-30370091 GCCCGTCGTGGTGGTGGCTCCGG - Exonic
1136988992 16:35140590-35140612 TGCTGCGGTGGCGGGGGCTGCGG - Intergenic
1137788692 16:51156083-51156105 GGGCGCCCTGGCGCCGGCTCGGG + Intergenic
1138247629 16:55479286-55479308 GGCGGCGGCGGCGGGGGCTGGGG + Exonic
1138450772 16:57092560-57092582 GGCGGCGGCGGCGGCGGCTCGGG - Exonic
1140091943 16:71846041-71846063 GGCCGCGGTTGCGGCGGCTCCGG + Exonic
1140223273 16:73058782-73058804 GGCAGCGGCGGCGGCGGCTCCGG - Intronic
1140347705 16:74230298-74230320 GGAGGCCGAGGCGGGAGCTCGGG - Intergenic
1141429847 16:83965875-83965897 GGCCCTCCTGGCGGGTGCTCTGG - Exonic
1141906929 16:87033099-87033121 GGCCGCCCTGGCGTGGGCTCAGG - Intergenic
1141964797 16:87434626-87434648 GGCGCCCGTGGAGAGGGCTCTGG - Intronic
1141989747 16:87602978-87603000 GGCGGCCGCGGCGCCGGCTCCGG - Exonic
1142089454 16:88202325-88202347 GGCCGCTTTGGCTCGGGCTCAGG + Intergenic
1142163332 16:88570623-88570645 GGCCGCCGAGGCGGCGGCGGCGG + Intronic
1142179780 16:88662792-88662814 GGCAGCCGTCGCGGGGGAACGGG + Intronic
1142188383 16:88705861-88705883 GGCGGCTGCGGCGGGCGCTCCGG - Intronic
1142336099 16:89490357-89490379 GGCGGCGGCGGCGCGGGCTCGGG + Exonic
1142488083 17:259702-259724 AGCCGCCGTGGCGGTGGCCGGGG + Intronic
1142764668 17:2058487-2058509 GGCCGGCGCGGCCGGGGCGCTGG + Exonic
1142876288 17:2853636-2853658 GGCGGCCGAGGCCGGGGCGCGGG + Intronic
1142876385 17:2853896-2853918 GGGGGCCGGGGCGCGGGCTCAGG + Intronic
1143446749 17:7014439-7014461 GGCCCCCGTGGAGAGGGCTGAGG + Exonic
1144269114 17:13600830-13600852 TGCCGCAGTGGCGGAGGCGCCGG - Exonic
1145919330 17:28598837-28598859 GGCTGCTGTCGCGGGGGCACCGG - Intronic
1145937987 17:28726289-28726311 GGCGGGCGGGGCGGGGGCGCGGG - Intronic
1146022635 17:29292894-29292916 GGCCGCGGTGCGGGGGGCGCCGG + Intronic
1146332342 17:31937426-31937448 GGCGGCAGCGGCGGGGGCTGCGG + Exonic
1147123713 17:38351965-38351987 GGCCGCGGCGGGCGGGGCTCCGG + Intergenic
1147315490 17:39618176-39618198 GCCGGGCGGGGCGGGGGCTCCGG + Intergenic
1147970976 17:44219083-44219105 GGAGGCCGGGGCGGGGGCGCCGG - Intronic
1148126932 17:45241975-45241997 GGCGGCGCAGGCGGGGGCTCCGG - Exonic
1148262185 17:46193348-46193370 GGCGGCGGTGGCGGCGGCACTGG + Intronic
1148440407 17:47709003-47709025 GGCGGCGGTGGCCGGGGCTGCGG - Exonic
1149840927 17:59964544-59964566 GGCCGCGGCGCAGGGGGCTCTGG - Intronic
1150648557 17:66995119-66995141 GGCCTCCGTGGAGGTGGCCCTGG + Intronic
1150676069 17:67246180-67246202 GGGCGCCTTGGCGCGGGCTGAGG + Intergenic
1151558694 17:74859892-74859914 GGCGGCGGCGGCGGCGGCTCCGG + Intronic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1152174922 17:78781599-78781621 CGCCGGCGAGGCGCGGGCTCCGG - Intronic
1152541914 17:80981135-80981157 GGGCGCGGGGGCGGGGGCACGGG - Intergenic
1152606328 17:81292804-81292826 TGCCACCGTGGAAGGGGCTCTGG - Intronic
1152676814 17:81645444-81645466 TGAGGCCGTGGCGGGGGCCCTGG + Exonic
1152677308 17:81648243-81648265 GGGCGCCGGGGCTGGGGCTCTGG - Exonic
1152714382 17:81891477-81891499 GGCGGCCGGGGCGGGGGCCGGGG - Exonic
1152835598 17:82528678-82528700 GGCCGCAGGGGCTGTGGCTCTGG - Intronic
1153040818 18:812022-812044 GGCGGCGGCGGCGGCGGCTCCGG + Intronic
1153265151 18:3262322-3262344 GGCCGCCCTGGGGCGGGGTCCGG - Intronic
1154303908 18:13217498-13217520 GGCCGCCGTGGCGGGGGCTCAGG - Intronic
1155257754 18:24014116-24014138 GGCGGCGGGGGCGGGGTCTCTGG - Intronic
1155762808 18:29588510-29588532 GGCCCCGGTGGCATGGGCTCAGG - Intergenic
1156266932 18:35497762-35497784 GGCAGCAGCGGCGGGGGCTATGG - Exonic
1157136671 18:45063468-45063490 GGCGGCGGTGGCGGGGGCAGGGG - Exonic
1158435993 18:57435828-57435850 GGCGGCAGTGGCGGGGGCGGCGG + Exonic
1158436019 18:57435908-57435930 GGCCCGCGTGGTGGGGGCTGGGG - Exonic
1158457512 18:57621469-57621491 GGCTGCGATGGCGGTGGCTCCGG - Intronic
1158457807 18:57622878-57622900 GGCTGCGATGGCGGTGGCTCCGG + Intergenic
1159941426 18:74411867-74411889 GGCCGCCAAGGCAGGGGCTGTGG - Intergenic
1160148746 18:76384249-76384271 GGGGGCCGTGGAGGGGGCACGGG - Intronic
1160515810 18:79478630-79478652 GATGGCCGTGGCGGGGGCTTTGG + Intronic
1160540117 18:79616746-79616768 GGCCGCCGGGGCCCGGGCTGGGG + Intergenic
1160784465 19:892988-893010 CGCAGCCGTGGCGGGGCCTGCGG - Intronic
1160856061 19:1218528-1218550 GGCCTCCGTGGGAGGGGCTGGGG + Intronic
1160861280 19:1238102-1238124 GGCCGCCGCGGCGGGTGCGGGGG - Intergenic
1160991657 19:1862806-1862828 GGCGGCAGTGGCGGGGGCTCCGG - Intronic
1160991702 19:1862911-1862933 GGCCGGCGCGGCGGCGGCCCGGG + Intronic
1160991986 19:1863788-1863810 GGCCGCCGGGGGCGGGGCTCGGG + Intergenic
1161087863 19:2343459-2343481 GGCCGCCTCAGCGGGGGCTTTGG - Intronic
1161400709 19:4065469-4065491 GGCGGCGGTGGCGGCGGCTGCGG + Intronic
1161667443 19:5585864-5585886 CGCCACCGTGGGGGAGGCTCCGG + Intergenic
1162021157 19:7869229-7869251 GGCGGCAGCGGCGGGGGCCCAGG - Exonic
1162363121 19:10231265-10231287 GGCGGCCGCGGCTGGGGCTGGGG + Exonic
1162935329 19:13978994-13979016 GGCGGCCGGGGCGGCGGCTCCGG + Intronic
1164977086 19:32581395-32581417 CGCCTCCGGGGCGGAGGCTCTGG + Intronic
1165042836 19:33081156-33081178 GGCCGCCGTAGCGAGGGGGCGGG + Exonic
1165131424 19:33634856-33634878 GGCTGCCGTGGTGAGGGCTCTGG + Intronic
1165268023 19:34677797-34677819 GTCCGCGGAGGCGCGGGCTCGGG + Exonic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1166043904 19:40218314-40218336 GGCGGGCGCGGCGGAGGCTCCGG + Exonic
1166189935 19:41169821-41169843 GGCAGCCGTGGCGGAAGCGCTGG - Intergenic
1166308075 19:41946538-41946560 GGTCGCTGTGGCTGGGGCACAGG - Intergenic
1166361246 19:42253855-42253877 GGCGGCGGCGGCGGCGGCTCGGG - Intronic
1166722988 19:45008361-45008383 GGCGGCTGTGGCTGGAGCTCTGG - Intronic
1167055988 19:47112073-47112095 GGGCGCCGTGGGGGGTGCTGCGG - Intronic
1167268282 19:48493972-48493994 GGCCGGCGGGGCGGGAGCGCCGG - Exonic
1167517690 19:49932778-49932800 GGCTGCTGTGGCGGGGGCAGAGG - Exonic
1167564705 19:50249073-50249095 AGGCGCCTTGGCGGGGGCTGCGG - Exonic
1167637979 19:50666514-50666536 GGCAGGCGTGGCGGGGGGTCCGG - Exonic
1168307218 19:55442319-55442341 GGCCGCGGGGGCGAGGGCCCCGG - Exonic
1168311544 19:55463414-55463436 AGCCGTCGTGGAGGGGCCTCTGG + Intergenic
1168322179 19:55517244-55517266 GGCCGCGGTGGCCGGCGCTCGGG - Exonic
926108960 2:10170048-10170070 GGCCCCCGGGACTGGGGCTCAGG + Intronic
927154776 2:20215255-20215277 GGGCACCCTGGCAGGGGCTCAGG - Intronic
927181101 2:20447289-20447311 GGCTGCCGCGGCGGGGGCGGTGG - Exonic
927472283 2:23385444-23385466 GGCGGCGGCGGCGGCGGCTCCGG - Exonic
927900621 2:26815766-26815788 GGCCGCCGGGTGGGGGGCGCCGG + Intergenic
928149089 2:28810521-28810543 GGCCCCCGGGGCTGGGGCTGCGG - Intronic
928511625 2:32009608-32009630 GGCTGCGGGCGCGGGGGCTCGGG + Intronic
929776596 2:44934388-44934410 GGCCCCCGGGGCTGGGGCACAGG - Intergenic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
932591775 2:73071749-73071771 GGCAGCTGTGGCGGGGGCCGAGG - Exonic
932700037 2:73985566-73985588 GGCTTCCGTGCCGGGGGCGCCGG + Intergenic
938301052 2:130213524-130213546 GGGGACCGGGGCGGGGGCTCCGG - Intergenic
938451541 2:131425323-131425345 GGCGGCGGCGGCGGCGGCTCGGG - Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
942446145 2:176080249-176080271 GGCGGCGGCGGCGGGGGCGCCGG - Exonic
942453623 2:176123268-176123290 GGCGGCCGTGGCGGGGGCCGGGG - Exonic
946378960 2:219331773-219331795 GGCCAGCGTGGCGGCGGCGCTGG + Intronic
946692480 2:222319737-222319759 GGCGGGCGCGGCGGGCGCTCAGG + Intergenic
947506631 2:230712928-230712950 AGGCGCCGGGGCGGGGGCACAGG + Exonic
947590501 2:231382550-231382572 GGCCGCTGTAACGGGGACTCAGG - Intergenic
948190534 2:236054869-236054891 GGCAGCCGGGGAGGGGGCCCGGG - Intronic
948454184 2:238097135-238097157 GGCCAGCGTGGCCGGGGCTGGGG + Intronic
948645226 2:239400436-239400458 GCCCGCCGGGGCGGGGGCGCGGG - Exonic
948870687 2:240796415-240796437 GACCTCCGTGGCCGGGGCCCTGG - Intronic
948874438 2:240819504-240819526 GGCGGGCGGGGCGGGGGCTGCGG - Intronic
948983819 2:241508339-241508361 GGACACCGGGGCGGGGGCACCGG - Intronic
949000395 2:241610042-241610064 GGTGGCCGTGCCGGGGACTCGGG - Intronic
949018693 2:241728324-241728346 GGCAGCTGTGGAGGGGGGTCTGG - Exonic
1168802758 20:653535-653557 GGCCGCGGGGGCGGGGGCGGGGG + Intronic
1171255896 20:23688912-23688934 GGCTACCCTGGCTGGGGCTCTGG - Exonic
1171904866 20:30892743-30892765 GGCAGCCCTGGCGGCGACTCTGG + Intergenic
1172284695 20:33732266-33732288 GGCCGGCGGGGAGGGGGCTCGGG + Intronic
1172317461 20:33967298-33967320 GGCCCCAGTGGCGGGGGAGCTGG - Intergenic
1172633442 20:36393879-36393901 GGCAGCTGAGGAGGGGGCTCAGG + Intronic
1172781101 20:37437496-37437518 GGCCTCCGTGTCTGGGGCCCAGG - Intergenic
1173620571 20:44432732-44432754 GGCGGCAGTGATGGGGGCTCAGG - Exonic
1173649124 20:44651787-44651809 GGCGGGCGGGGCGGGGGCTCCGG - Intronic
1173979257 20:47210612-47210634 AGCCCCCGCGCCGGGGGCTCAGG + Exonic
1175403521 20:58713522-58713544 GGCCACCCTGACCGGGGCTCAGG + Exonic
1175847039 20:62064854-62064876 GGCGGCCGGGGCGGGGGCGGGGG + Exonic
1176025436 20:62983084-62983106 GGCCTCCGTGGCGGGCACACAGG + Intergenic
1176194613 20:63831402-63831424 GGCCGGCGTGGGCGGGGCCCGGG - Intergenic
1176418897 21:6498943-6498965 GGCCCACGAGGCGGCGGCTCCGG + Intergenic
1176547496 21:8208129-8208151 GCCCGCAGAGGCGGCGGCTCCGG - Intergenic
1176548598 21:8212235-8212257 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176549491 21:8214997-8215019 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176555404 21:8252338-8252360 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1176556492 21:8256443-8256465 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176557386 21:8259226-8259248 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176566447 21:8391176-8391198 GCCCGCAGAGGCGGCGGCTCCGG - Intergenic
1176567529 21:8395270-8395292 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176568416 21:8398031-8398053 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176574322 21:8435363-8435385 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1176575431 21:8439485-8439507 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176576328 21:8442261-8442283 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176610934 21:8986655-8986677 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1178453708 21:32727976-32727998 GGCGGCTGTGGCGGCGGCTGCGG - Exonic
1178487049 21:33025860-33025882 GGCAGCGGTGGCGGGGGCGGGGG - Intronic
1178951634 21:36990305-36990327 GGCCGCGGTGCCGCGCGCTCGGG + Intergenic
1179213613 21:39348731-39348753 GGCCGCGGGGGCGGGCGTTCTGG - Intronic
1179694390 21:43107265-43107287 GGCCCACGAGGCGGCGGCTCCGG + Intronic
1180008450 21:45034119-45034141 GGCCGGCATGGCGGGGACACGGG + Intergenic
1180014708 21:45074590-45074612 GGCGGCCGTGGCGGCGGCGGCGG + Intronic
1181518520 22:23432150-23432172 GGCAGCCCTGGCAGGGGCTCTGG + Intergenic
1182237006 22:28883820-28883842 GGCCGCGGGGGCGGCGGCGCAGG - Exonic
1182282445 22:29225257-29225279 GGGAGCCCTGGAGGGGGCTCAGG + Intronic
1182355436 22:29720545-29720567 GGCCGCCGGGGCGGGGATCCCGG - Intronic
1183731773 22:39622390-39622412 GGCGGCAGTAGCGGGGGTTCAGG + Intronic
1183744776 22:39686061-39686083 GGCCGCGGTGGCGCGGGCGGCGG + Exonic
1184276415 22:43411786-43411808 GGCGGGCCTGGCGGGGGCCCCGG + Intronic
1184781465 22:46651784-46651806 GGCCGCCTTGGTGGCGGCACTGG + Intronic
1184840650 22:47050707-47050729 GCAGGCCATGGCGGGGGCTCGGG + Intronic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185212199 22:49576635-49576657 GACAGACGTGGCCGGGGCTCAGG - Intronic
1185254340 22:49823982-49824004 GGCCGGCGTGCCGTGGGCGCTGG + Exonic
1185377350 22:50488540-50488562 GGCAGCCGTGGGGGGGGCCGTGG - Intronic
1185381303 22:50508488-50508510 GGGCTGCGGGGCGGGGGCTCCGG + Intronic
1203252368 22_KI270733v1_random:124414-124436 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1203254378 22_KI270733v1_random:131319-131341 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203260425 22_KI270733v1_random:169500-169522 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1203261536 22_KI270733v1_random:173618-173640 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1203262434 22_KI270733v1_random:176398-176420 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
950446621 3:13042459-13042481 GGCCGCCGTGGCAGGGACCAGGG - Intronic
950703616 3:14766843-14766865 AGCCGCCCTGGCTGGGGGTCAGG - Intronic
950707776 3:14793637-14793659 GCCCGCCCAGGCGGGGCCTCGGG + Intergenic
951080463 3:18445284-18445306 GGCGGCGGCGGCGGCGGCTCGGG - Intronic
954152038 3:48662599-48662621 GGCCGCCGTGGCGGGGCCTCGGG - Exonic
954378177 3:50205664-50205686 GGACGCCTTGTTGGGGGCTCGGG + Intronic
956681469 3:71785326-71785348 GGCGCCCGAGGCGGGGGCGCGGG - Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960096662 3:113696389-113696411 GGCCGCGGTGGCGGCGGCGACGG + Exonic
961698865 3:128726334-128726356 GGCCGCTGCGCTGGGGGCTCCGG - Exonic
962244775 3:133783764-133783786 GGCAGCCGCGGCCAGGGCTCCGG - Intergenic
964751904 3:160060836-160060858 GGCACTCGTGGCGGGGGCTCAGG - Intergenic
966181888 3:177196531-177196553 GGCCGGCGTGCTGGGGGCTGCGG - Intronic
966808751 3:183825611-183825633 GGCCGCGGGGGCGGGGACGCTGG - Intergenic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
967922494 3:194623497-194623519 GGCCACCGTGGGGAGGACTCGGG - Intronic
967992610 3:195142699-195142721 GGCAGCCGGGGCTGGGGCTGGGG + Intronic
968654400 4:1772314-1772336 AGCCTCCGAGGCGGGGGGTCGGG + Intergenic
968704116 4:2070080-2070102 GGCAGCCTTGGCCTGGGCTCGGG + Intergenic
968751300 4:2390482-2390504 GGACCCCATGTCGGGGGCTCAGG + Intronic
968775380 4:2536812-2536834 GGCCGCGGCGGCGGGCGCTCCGG - Intronic
968962205 4:3751361-3751383 GGCAGCAGGGGCCGGGGCTCTGG - Intergenic
969611909 4:8232204-8232226 GGGCGGCGGGGCGGGGGCACAGG + Intronic
970456220 4:16226549-16226571 GGCGGCGGCGGCGGCGGCTCGGG - Intronic
972726863 4:41752090-41752112 GGGCGCTGGGGCTGGGGCTCTGG - Intergenic
977257726 4:94758520-94758542 GCCCGGCGGGGCGGGGGCCCAGG + Intronic
978271304 4:106893604-106893626 GGGCGCCCTGGCTGGGGCTGAGG - Intergenic
984167531 4:176320297-176320319 GGCTGCCGTGCCGGGGCCGCGGG + Intronic
984206461 4:176792763-176792785 GGGCGCTGCGGCGGGGGCGCTGG + Intergenic
985894054 5:2738821-2738843 GGCGGCCCTGACTGGGGCTCTGG - Intergenic
986813665 5:11385174-11385196 GGCGGCGGCGGCGCGGGCTCGGG + Exonic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
988564885 5:32312867-32312889 GGACGCAGAGGCGGCGGCTCGGG + Exonic
988796285 5:34656284-34656306 GGCCGGCGGGGCGGGGGCAGCGG - Intronic
991588793 5:68226934-68226956 GGCCGAGGTGGCCGGGGCTTTGG - Exonic
992269937 5:75053562-75053584 GGCCGCCCCGGCGGGGGCCGAGG + Intergenic
992528832 5:77636979-77637001 GGCCGGCTTGGCTGGGGTTCGGG + Exonic
993116213 5:83722421-83722443 AGCCGCCGGGACGGGGGCTCTGG + Intergenic
995574424 5:113514133-113514155 GGCCGCCGTTTGGGGGGCGCTGG - Intronic
995650083 5:114361089-114361111 GGCCGCCGGGTCCTGGGCTCTGG - Exonic
996862651 5:128083702-128083724 GGCTGCGGCGGCGGCGGCTCCGG - Intergenic
997500741 5:134371520-134371542 GGCCGCCGCGCCGGGGGGTGGGG + Exonic
998407340 5:141881641-141881663 GGCAGCCGTGACAGGGGCTGAGG - Intergenic
1001065058 5:168529544-168529566 GGCCGCGGGGGCGGCGGCTGGGG + Exonic
1001070310 5:168579570-168579592 GGCGGCGGTGGCGGCGGCTCCGG - Exonic
1001495978 5:172188049-172188071 GGGCGCGGTGGCGCCGGCTCGGG + Exonic
1002006424 5:176238378-176238400 GGCCGGCGTGGCGGTGGCCCGGG + Exonic
1002055212 5:176594757-176594779 GGCGGTGGTGGCCGGGGCTCTGG + Intronic
1002160659 5:177312284-177312306 TGCCGCGGGGGCGGGGCCTCCGG + Exonic
1002219954 5:177672259-177672281 GGCCGGCGGGGCGGTGGCCCGGG - Intergenic
1002394244 5:178940995-178941017 GGTCGGCGTGGAGGGGTCTCTGG + Intergenic
1002926779 6:1609711-1609733 GGCCGCCCTGGCCCGGGCCCCGG - Intergenic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003507324 6:6750811-6750833 GGACACCGTGGCGAGAGCTCCGG + Intergenic
1003983941 6:11417082-11417104 GCCCACCATGGGGGGGGCTCGGG + Intergenic
1004722182 6:18277347-18277369 GGCCGCCGGGGCGAGGGCCGAGG + Intergenic
1005303777 6:24495065-24495087 GGCCGCCGGCGCGGGGGCGGAGG - Exonic
1005851727 6:29827966-29827988 GGCCGGCCCGGCGGGGGCGCAGG + Intronic
1005866662 6:29942675-29942697 GGCCCTCCTGGCGGGGGCGCAGG + Intronic
1006458565 6:34145190-34145212 GCCCGCCGCGGCCCGGGCTCTGG - Intronic
1006558562 6:34889502-34889524 GGCGGCGGCGGCGGTGGCTCTGG + Exonic
1007665288 6:43509917-43509939 GGCGGCTGTGGCGGAGGCTGCGG + Exonic
1007752022 6:44076598-44076620 CGGCGGCGTGGCGGGGACTCTGG + Intergenic
1009905668 6:69867495-69867517 GGCCGCTGTGGCTGCGGCGCCGG - Intronic
1010269376 6:73903428-73903450 GGCCACCGGGGGGGGGGCTCGGG - Intergenic
1013099480 6:106974867-106974889 GGCGGCGGCGGCGGGGGCGCTGG - Intronic
1014788516 6:125644760-125644782 GGCCCTCGTGGAGGAGGCTCGGG - Intergenic
1017662424 6:156687447-156687469 GGCCGCCGCGGCCGGGGCGTGGG - Intergenic
1017929408 6:158939173-158939195 GGCCGCAGTGCCGGGGCCGCAGG - Intergenic
1018727787 6:166627116-166627138 GGCCGCCGTGCCGGGCTCCCTGG - Intronic
1018754518 6:166837589-166837611 TGGCCCCGTGGCTGGGGCTCTGG + Intronic
1018915344 6:168129425-168129447 GGCGGCCGGGGCCGGGGCTGGGG + Intergenic
1019200043 6:170306764-170306786 GGCGGCTGTGGCGGTGGCTGAGG + Exonic
1019307879 7:344411-344433 GGCCGCTGTGGGGGCGACTCTGG - Intergenic
1019378967 7:711733-711755 GGCAGGGGTGGAGGGGGCTCAGG + Intronic
1019600045 7:1876794-1876816 GGCAGCCCTGGCAGGGGCTCTGG - Intronic
1019814458 7:3189478-3189500 GCCCTCCCTGGCGGGGGCTGAGG + Intergenic
1022094567 7:27130612-27130634 GGCGGCCCGGGCGGGGGCCCCGG - Exonic
1022136938 7:27457828-27457850 GGCCGCCGTGGGGGGGCGTTTGG - Intergenic
1023418148 7:39950847-39950869 GGCCGCGGCGGCGGCGGCTGCGG - Exonic
1024208502 7:47184029-47184051 GGCTGCAGTGGCGGGGGGTGGGG - Intergenic
1024579853 7:50793038-50793060 CGCCTCCGGGCCGGGGGCTCCGG - Intronic
1026471107 7:70694585-70694607 GCGCGCCGCGGCGGCGGCTCAGG + Intronic
1026926204 7:74195621-74195643 GGCCGCCGTGGGGGGGCGTTTGG + Exonic
1027001608 7:74658097-74658119 GGCCCCCGAGGCGGGGGCGGGGG - Intronic
1027228599 7:76260041-76260063 GGCCGCCGCGGCGGGGGTGGGGG + Intronic
1029570242 7:101363761-101363783 GACCGCCGTGGCTGGGGCTGGGG + Intronic
1029609419 7:101618774-101618796 GGGCGCCGGGACTGGGGCTCCGG - Intronic
1029927005 7:104328784-104328806 GGCGGCAGCGGCGGCGGCTCCGG - Exonic
1030304156 7:108002609-108002631 GGCCGCAGGGGCCGGGGCTTGGG + Intronic
1030739063 7:113086566-113086588 GGCCGCGGCGGCGGCGGCTGCGG + Intronic
1032083174 7:128870008-128870030 CGCCGCCGGGCCGGGGGCTTCGG + Intronic
1032125331 7:129189051-129189073 GGCGGCCGCGGAGGCGGCTCAGG - Exonic
1034192641 7:149223865-149223887 GGCTGCGGTGGCTGGGGCTGGGG - Exonic
1034446081 7:151115007-151115029 GGCGGCCGAGGCGCGGGCGCAGG - Intronic
1035023018 7:155809842-155809864 GGCCCCCGGGCTGGGGGCTCCGG + Intronic
1035187776 7:157139374-157139396 GGCCTGCGCGGCCGGGGCTCGGG + Intronic
1035187806 7:157139458-157139480 GGCCTCCCTGGCGGGGACTCGGG + Intronic
1035466599 7:159083570-159083592 GGCTGCCCTGGCTGTGGCTCTGG - Intronic
1036952481 8:13154287-13154309 GCCCGCTGCGGTGGGGGCTCAGG + Intronic
1038023789 8:23571569-23571591 GGCGGCCGCGGCGAGGGCCCCGG - Exonic
1038761260 8:30385211-30385233 GGCCGGCGGGGCGCGGGCCCGGG + Intronic
1040692186 8:49952492-49952514 GGCTGCTGTGGCTGGAGCTCAGG + Intronic
1041059504 8:54022285-54022307 GGCGGCGGCGGCGGCGGCTCCGG + Exonic
1046547319 8:115668500-115668522 GGCCGCGGGGCCGGGGGCTGCGG - Intronic
1047961712 8:130016210-130016232 GGCCGCCGGGCCGGGCGCTGCGG - Intronic
1049177909 8:141205731-141205753 GGCGGCCGTGACGGCGGCGCAGG - Intergenic
1049354881 8:142182650-142182672 GGCCACCGTGGGGAGGGCACCGG + Intergenic
1049446674 8:142634536-142634558 GGCCTCTGTGGCAGGGGCTAGGG - Intergenic
1049548573 8:143246229-143246251 CGCCGCGGAGGCGGGGGCTGGGG + Intergenic
1049778015 8:144415365-144415387 GGCGGTGGGGGCGGGGGCTCCGG - Exonic
1049936404 9:504881-504903 GGCGGCCGTGGCGGTGGCGGAGG + Intronic
1055514205 9:77020314-77020336 GGCGGCCGTGGCGGCGGCGGCGG + Exonic
1055611778 9:78031584-78031606 GGCGGCGGCGGCGGCGGCTCGGG - Intergenic
1056070723 9:82983885-82983907 GGCCACCGGGGCTGTGGCTCGGG - Intronic
1057490451 9:95516218-95516240 GGCCTCGGGGGCGGGGGCCCGGG + Intronic
1057596226 9:96418040-96418062 GGCCGCCGGAGCTGGGGGTCGGG - Exonic
1057708077 9:97412153-97412175 GGCGGCCGCGGCGGGGCCCCTGG + Exonic
1057733766 9:97633923-97633945 GGCCTCCGTGGCCGGGCCGCAGG - Intronic
1057787137 9:98095773-98095795 GACAGCAGTGGTGGGGGCTCTGG + Intronic
1057801088 9:98192053-98192075 GGCCGGCTTGGCGGGGACCCGGG + Intronic
1059375256 9:113876230-113876252 GGCCGGGGGGGCGGGGGCGCTGG - Intergenic
1059769839 9:117414841-117414863 GGCAGCAGTGGCGGCGGCCCCGG + Exonic
1060661708 9:125408504-125408526 GGCCGCTAGGGCGGGGGCCCCGG + Intergenic
1060856064 9:126915341-126915363 GGCTGCCGTGGGCGGGGCTGTGG + Intronic
1060974254 9:127755204-127755226 GGCCGGCGGGGCAGGGGCGCAGG + Intronic
1060979856 9:127785817-127785839 GGGCGCCGGAGCTGGGGCTCGGG - Intronic
1061000433 9:127899456-127899478 GGCCGCGGGGGCGGGGGCGGAGG - Intronic
1061028653 9:128066819-128066841 GGCCGCCGTGGAGGGTGGTGAGG - Exonic
1061293926 9:129666912-129666934 GGCCGGCCTGCTGGGGGCTCTGG + Intronic
1061843748 9:133375687-133375709 GGGCGCCGAGGCCCGGGCTCCGG + Intronic
1061962258 9:133994029-133994051 GGCTGGTGAGGCGGGGGCTCAGG + Intergenic
1062012082 9:134272810-134272832 GGCCGCAGTGGCCAGGGCTGGGG - Intergenic
1062357031 9:136169954-136169976 TGACGCCGTGGCAGGGGCTGGGG - Intergenic
1062461892 9:136665756-136665778 GGCCCCCACGGCGCGGGCTCGGG + Intronic
1062465309 9:136678230-136678252 GGCTGCTGTGGCCAGGGCTCAGG - Intronic
1062526927 9:136981656-136981678 GGGAGCCGGGGCAGGGGCTCGGG - Exonic
1062527733 9:136985100-136985122 GGACGCCCTGGCTGGGGCTCAGG - Exonic
1062537647 9:137027923-137027945 GCCCGGCGGGGAGGGGGCTCGGG + Intronic
1062615742 9:137394975-137394997 GGCCGCAGAGGTGGGAGCTCTGG - Intronic
1062696352 9:137878008-137878030 GGCCGGCGGGGCGGGGGGCCCGG + Exonic
1203468773 Un_GL000220v1:107565-107587 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1203469882 Un_GL000220v1:111687-111709 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1203470779 Un_GL000220v1:114463-114485 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203476594 Un_GL000220v1:151537-151559 GCCCGCAGAGGCGGCGGCTCGGG - Intergenic
1203477703 Un_GL000220v1:155659-155681 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1203478600 Un_GL000220v1:158435-158457 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1186611153 X:11139361-11139383 GCCCTCCGTCGCGGGGGCTGCGG + Exonic
1189322790 X:40096706-40096728 GGCGGCGGTGGCGGCGGCTGGGG + Intronic
1189821398 X:44873022-44873044 GGCCTCGGTGGGCGGGGCTCGGG + Intergenic
1196400572 X:115311968-115311990 GGCCGCGGTGCAGGGGGCACGGG + Intergenic
1198100034 X:133415288-133415310 GGCCGGCGAGGCGGGGACGCGGG + Exonic
1200100660 X:153688027-153688049 GGCGGCGGCGGCGGCGGCTCGGG - Intronic
1200147571 X:153934655-153934677 GGCCTCCGTTGGGTGGGCTCCGG - Intronic