ID: 1154303910

View in Genome Browser
Species Human (GRCh38)
Location 18:13217504-13217526
Sequence TACCGGGGCCGCCGTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154303910_1154303926 13 Left 1154303910 18:13217504-13217526 CCCCCGCCACGGCGGCCCCGGTA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1154303926 18:13217540-13217562 CGCGCGCCGGGTCCCCACCGCGG 0: 1
1: 0
2: 2
3: 13
4: 107
1154303910_1154303927 18 Left 1154303910 18:13217504-13217526 CCCCCGCCACGGCGGCCCCGGTA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1154303927 18:13217545-13217567 GCCGGGTCCCCACCGCGGAGTGG 0: 1
1: 0
2: 2
3: 7
4: 116
1154303910_1154303935 29 Left 1154303910 18:13217504-13217526 CCCCCGCCACGGCGGCCCCGGTA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1154303935 18:13217556-13217578 ACCGCGGAGTGGGAAGGAGGAGG 0: 1
1: 0
2: 1
3: 31
4: 327
1154303910_1154303930 23 Left 1154303910 18:13217504-13217526 CCCCCGCCACGGCGGCCCCGGTA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1154303930 18:13217550-13217572 GTCCCCACCGCGGAGTGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1154303910_1154303933 26 Left 1154303910 18:13217504-13217526 CCCCCGCCACGGCGGCCCCGGTA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1154303933 18:13217553-13217575 CCCACCGCGGAGTGGGAAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 160
1154303910_1154303929 19 Left 1154303910 18:13217504-13217526 CCCCCGCCACGGCGGCCCCGGTA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1154303929 18:13217546-13217568 CCGGGTCCCCACCGCGGAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 59
1154303910_1154303923 1 Left 1154303910 18:13217504-13217526 CCCCCGCCACGGCGGCCCCGGTA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1154303923 18:13217528-13217550 CCGCGGCCTGGCCGCGCGCCGGG 0: 1
1: 0
2: 4
3: 43
4: 306
1154303910_1154303921 0 Left 1154303910 18:13217504-13217526 CCCCCGCCACGGCGGCCCCGGTA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1154303921 18:13217527-13217549 CCCGCGGCCTGGCCGCGCGCCGG 0: 1
1: 0
2: 2
3: 38
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154303910 Original CRISPR TACCGGGGCCGCCGTGGCGG GGG (reversed) Intronic
902350110 1:15847965-15847987 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
903750582 1:25618051-25618073 GCCCGGGGCCGGCGCGGCGGGGG - Exonic
904649172 1:31991540-31991562 TACAGGGGCAGCCGTGAAGGAGG + Intergenic
905416669 1:37808583-37808605 TCCCGGGGCGGCTGTGGGGGTGG - Exonic
906365423 1:45205980-45206002 TACCGGGGCGGCCCCGGCGCCGG - Exonic
906640676 1:47438867-47438889 TGGCGGGGCCGCGGCGGCGGGGG + Exonic
907962519 1:59296760-59296782 TACAGGGGCCGCGCCGGCGGGGG + Intronic
911527541 1:99004752-99004774 CACCGGGGGCGCGGCGGCGGAGG + Exonic
915463176 1:156081708-156081730 TGCGGGGGCCGCCGTCGGGGCGG + Exonic
916098986 1:161377318-161377340 TACAGGGCCCACCGTGGTGGTGG - Intergenic
917565365 1:176207216-176207238 TACAGGGACCGCGGTGGCGGCGG - Exonic
917846667 1:179025955-179025977 GGCCGGAGCCGCTGTGGCGGCGG + Exonic
924289721 1:242524713-242524735 TCCCGGGGCGGCGGCGGCGGCGG + Intergenic
1063448032 10:6132447-6132469 TACCGGGGCCTCCTTGAGGGTGG + Intergenic
1064086505 10:12349648-12349670 GACCGCGGCCGCGGCGGCGGCGG + Exonic
1066023085 10:31320860-31320882 TACCGGGGCGGCGCAGGCGGGGG - Intronic
1073266418 10:102230802-102230824 GCCCGGGGCAGCCGCGGCGGAGG + Exonic
1074814472 10:117134235-117134257 TCCCGGGCCCGCCGGGCCGGGGG - Exonic
1077074675 11:694966-694988 GGCCGCGGCCGCTGTGGCGGCGG - Exonic
1079237109 11:18698879-18698901 GACCGGGGACACCATGGCGGCGG - Exonic
1083728821 11:64642536-64642558 TACCGTGGCCGCCGCGGGTGAGG + Intronic
1083904828 11:65662770-65662792 CGCCGGGGCCGCCGCGGCTGTGG - Intronic
1084662011 11:70551509-70551531 CACCGGGGCTGCCGAGGCCGGGG - Intronic
1091211323 11:133864009-133864031 TACTGAGGCCACAGTGGCGGGGG + Intergenic
1092241395 12:6838373-6838395 TACCAGGGCCGCCTTGACTGGGG + Intronic
1095261745 12:40105954-40105976 CCCCGGAGCGGCCGTGGCGGCGG - Intronic
1100089706 12:90954684-90954706 AACCTGGGCGGCGGTGGCGGCGG - Exonic
1104844226 12:131838764-131838786 GAGCGGGGCCTCCGTGGAGGTGG + Intronic
1105389195 13:19959161-19959183 TCGCGGGGCCGGCGGGGCGGCGG + Intronic
1105601977 13:21895629-21895651 TAGAGGGGCCGGCGTGGCTGTGG - Intergenic
1105830754 13:24161285-24161307 TACAGGGGCGGCCGTGGGGGTGG + Intronic
1106719935 13:32427329-32427351 GCCCGGGGCGGCCGTGGCAGTGG - Intronic
1108046108 13:46386572-46386594 GACCGTGTCCGGCGTGGCGGGGG + Intronic
1112324834 13:98436997-98437019 TACCAGTGCCGGGGTGGCGGGGG + Intronic
1112692884 13:101916636-101916658 TCCCGGGGCCACCATGGCCGCGG - Intronic
1113378792 13:109785510-109785532 TGCCGGCGCCGCCGGGGCCGAGG - Exonic
1113517756 13:110915692-110915714 TCCCGGGGCCTCCGGCGCGGTGG + Intergenic
1127414942 15:58749224-58749246 TCCCGGGGCCGCCAGGGCGGTGG + Intronic
1127867188 15:63042503-63042525 GACCCGAGCCGCCGAGGCGGCGG - Intergenic
1128309694 15:66622362-66622384 GGCCAGGGCCGCCGTGGCGACGG + Intronic
1130936878 15:88478198-88478220 TACAGGGGCAGCCGTGGCCTAGG + Exonic
1137787907 16:51152401-51152423 AACCGGGGCAGCCGGGGGGGAGG - Intergenic
1140209184 16:72957817-72957839 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1141906932 16:87033105-87033127 CCCCGGGGCCGCCCTGGCGTGGG - Intergenic
1142188597 16:88706579-88706601 TACCTGGGCCGCGGCGCCGGGGG - Exonic
1142509741 17:386029-386051 TTCCGGGGCCGGCGGGGCGCGGG - Intronic
1142552891 17:751968-751990 TCCCGGGGTGGCCTTGGCGGGGG - Intronic
1142980590 17:3668901-3668923 TAACTGGGCCACCGTGGCCGGGG + Exonic
1143148260 17:4790176-4790198 TCCCGGAGCCACCGAGGCGGAGG + Exonic
1144601360 17:16617616-16617638 TACGGAAGCCGCCGTGGTGGAGG - Intergenic
1145305849 17:21674690-21674712 GACTGGGGCAGCGGTGGCGGCGG + Intergenic
1147971265 17:44219980-44220002 GACCCGGGCGGCCGAGGCGGAGG + Intronic
1148664077 17:49361852-49361874 TGCCGGGGGCGCCGCCGCGGCGG + Intronic
1150388707 17:64779052-64779074 TGCCGCGGCCGCAATGGCGGCGG - Intergenic
1152714367 17:81891438-81891460 TCCCAGGGCGGCCGCGGCGGTGG - Exonic
1154303910 18:13217504-13217526 TACCGGGGCCGCCGTGGCGGGGG - Intronic
1156458388 18:37307492-37307514 TAGCAGGGCCGCTGTGGTGGTGG - Intronic
1157464312 18:47930841-47930863 TACCCGCGCGGCCGCGGCGGCGG - Intronic
1157761517 18:50268693-50268715 TACCTAGGCCGCGGGGGCGGGGG - Intronic
1161963645 19:7535947-7535969 GATCGGGGCCGGAGTGGCGGTGG + Exonic
1162481331 19:10928592-10928614 CACCTGGGCCGGCGTGGCTGGGG + Exonic
1162536635 19:11266332-11266354 GACTGGGGCCTCCATGGCGGAGG - Intergenic
1163154472 19:15432490-15432512 TCCCGCGGCGGCGGTGGCGGTGG + Intronic
1165510970 19:36266527-36266549 GACCGGGGCGGCGGTGGCGGCGG - Intergenic
1165886774 19:39084344-39084366 TACCGGGGCGGCGCTGGTGGCGG + Exonic
1166210346 19:41302826-41302848 TTCCGGGGCCGCGGGGGTGGTGG + Exonic
1168386260 19:55965811-55965833 TACCGGGGCCTCTGGGGGGGTGG - Intronic
934067213 2:88351055-88351077 AGCCGGCGCCGCCGTGGCGCAGG - Intergenic
934261194 2:91478107-91478129 CACCGGGGCGGCGGCGGCGGCGG - Intergenic
942446160 2:176080285-176080307 TCCCGGGGTGGCGGTGGCGGCGG - Exonic
942450898 2:176107578-176107600 TACCGCGGCGGCGGCGGCGGCGG + Exonic
1171531095 20:25854150-25854172 GACTGGGGCAGCGGTGGCGGCGG + Intronic
1172427195 20:34863342-34863364 TACCGGTGTCACCGTGGCGCTGG - Exonic
1178487341 21:33027458-33027480 TGCCGGGTGCGCGGTGGCGGCGG - Exonic
1178534967 21:33403593-33403615 TGGCGGGGCCGCGGCGGCGGCGG - Exonic
1180816144 22:18791087-18791109 CACCAGGGCTGCCGTGGCCGCGG - Intergenic
1181491496 22:23263123-23263145 GACAGGGGCGGCCATGGCGGCGG + Intronic
1181699371 22:24611195-24611217 CACCAGGGCTGCCGTGGCCGCGG + Exonic
1182094069 22:27614473-27614495 CACGGCGGGCGCCGTGGCGGTGG + Intergenic
1182578976 22:31292388-31292410 AACCGAGGCCCCCTTGGCGGCGG + Exonic
1203224579 22_KI270731v1_random:69994-70016 CACCAGGGCTGCCGTGGCCGCGG + Intergenic
1203266247 22_KI270734v1_random:16798-16820 CACCAGGGCTGCCGTGGCCGCGG - Intergenic
952287294 3:31981208-31981230 TGCCGGGGCCGCCACCGCGGCGG - Exonic
964720627 3:159764798-159764820 CACCGGGGGCGGCATGGCGGTGG - Exonic
965520461 3:169664392-169664414 GACCGGGGCAGCAGTGGGGGAGG - Intergenic
968625068 4:1623336-1623358 TCCCGGGGCTGCGGTGGGGGTGG - Intronic
968834725 4:2955085-2955107 TAGAGGGGGCGCCGTGGCGCAGG - Intronic
969394256 4:6910158-6910180 TTACGGGGCCTCCGGGGCGGGGG + Intronic
970456241 4:16226634-16226656 TACCGTGGCGGCGGCGGCGGCGG - Intronic
975883608 4:78939399-78939421 TGCCGGGTCCGCCGCGGCGCTGG - Exonic
984765718 4:183398923-183398945 TCCCGGGTCCGCCGCGGCCGCGG + Intergenic
985504616 5:271853-271875 GGTCGGGGCCGCCGCGGCGGAGG - Intronic
991587733 5:68216442-68216464 TCCCGGGGCGGGCGAGGCGGCGG + Intronic
992098360 5:73382243-73382265 TACCGGGGCCGTCCGGCCGGAGG + Intergenic
995650114 5:114361182-114361204 TCCCGGGTCCCCCCTGGCGGGGG - Intronic
999689951 5:154138219-154138241 TACCTGGGAGGCCGAGGCGGAGG + Intronic
1002006422 5:176238372-176238394 GGGCGGGGCCGGCGTGGCGGTGG + Exonic
1014035588 6:116764691-116764713 TTGCGGGGCGGCTGTGGCGGGGG - Intronic
1015149091 6:130019281-130019303 GAGCGCGGCCGCCGAGGCGGGGG + Intronic
1019379094 7:712161-712183 CTCCGGGGGCGGCGTGGCGGGGG - Intronic
1019474221 7:1236314-1236336 GCCAGGGGCCGCTGTGGCGGCGG + Exonic
1023064841 7:36367021-36367043 GACCCGGGCCTCGGTGGCGGGGG + Intronic
1025069674 7:55887588-55887610 TCCCGGGTCCACCGCGGCGGCGG + Intronic
1028881954 7:95890412-95890434 TACTGGGGCCTCCTTGACGGTGG + Intronic
1029075077 7:97928489-97928511 GCCCGGGCCCGGCGTGGCGGAGG - Intergenic
1031899446 7:127392871-127392893 GACCGGGGCCGCCGGCGCGAGGG + Intronic
1032002158 7:128272310-128272332 TTCGGGGGCCGCCGAGGCTGGGG - Intergenic
1032463747 7:132130447-132130469 TTCCAGGGCCGCCCTGGAGGGGG - Exonic
1034423384 7:151000641-151000663 TACGGGGGCAGCAGGGGCGGGGG + Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1038632942 8:29262943-29262965 CTCCTGGGCCGCCGGGGCGGAGG - Intronic
1041689913 8:60678755-60678777 TGCTGGGGCCGCGGCGGCGGCGG + Intergenic
1045124035 8:99070012-99070034 TACTTGGGATGCCGTGGCGGGGG - Intronic
1049194515 8:141308107-141308129 GGCCGGGGCCGCGGGGGCGGCGG + Intronic
1049936402 9:504875-504897 TTGCGCGGCGGCCGTGGCGGTGG + Intronic
1051079688 9:13279654-13279676 GACCGGGGCTGCCGCGGAGGCGG + Intergenic
1054172816 9:61856458-61856480 TATCGCTGCCGCCGCGGCGGCGG - Intergenic
1054664724 9:67724343-67724365 TATCGCTGCCGCCGCGGCGGCGG + Intergenic
1056475397 9:86947236-86947258 GACCGCGGCGGCGGTGGCGGCGG - Intergenic
1057881528 9:98796302-98796324 GCCCGGGGCCGCAGCGGCGGGGG - Exonic
1060713079 9:125889933-125889955 AGCCGGGGCCGCCGGCGCGGGGG - Intronic
1062578811 9:137220914-137220936 TTACGGGGCCGCCGTGGCAGTGG + Exonic
1189407092 X:40735295-40735317 CCCGGGAGCCGCCGTGGCGGCGG - Exonic
1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG + Exonic
1199179839 X:144840960-144840982 TACCCGGGCTGCTGTGGCAGGGG + Intergenic
1200000190 X:153056250-153056272 CCCGGGGGCCCCCGTGGCGGGGG + Intergenic
1202338256 Y:23832467-23832489 AACCAGGGCAGCCGTGGCGATGG - Intergenic
1202532510 Y:25837604-25837626 AACCAGGGCAGCCGTGGCGATGG + Intergenic