ID: 1154303969

View in Genome Browser
Species Human (GRCh38)
Location 18:13217703-13217725
Sequence GGACGCGGCGCTGCGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 286}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154303969_1154303976 3 Left 1154303969 18:13217703-13217725 CCGGCGGCCGCAGCGCCGCGTCC 0: 1
1: 0
2: 4
3: 34
4: 286
Right 1154303976 18:13217729-13217751 CTCTCCCCGCGCTGAGGCTGCGG 0: 1
1: 0
2: 2
3: 16
4: 183
1154303969_1154303981 9 Left 1154303969 18:13217703-13217725 CCGGCGGCCGCAGCGCCGCGTCC 0: 1
1: 0
2: 4
3: 34
4: 286
Right 1154303981 18:13217735-13217757 CCGCGCTGAGGCTGCGGACCGGG 0: 1
1: 0
2: 0
3: 8
4: 174
1154303969_1154303984 18 Left 1154303969 18:13217703-13217725 CCGGCGGCCGCAGCGCCGCGTCC 0: 1
1: 0
2: 4
3: 34
4: 286
Right 1154303984 18:13217744-13217766 GGCTGCGGACCGGGCCCGGCGGG 0: 1
1: 0
2: 3
3: 30
4: 328
1154303969_1154303979 8 Left 1154303969 18:13217703-13217725 CCGGCGGCCGCAGCGCCGCGTCC 0: 1
1: 0
2: 4
3: 34
4: 286
Right 1154303979 18:13217734-13217756 CCCGCGCTGAGGCTGCGGACCGG 0: 1
1: 0
2: 0
3: 10
4: 150
1154303969_1154303972 -3 Left 1154303969 18:13217703-13217725 CCGGCGGCCGCAGCGCCGCGTCC 0: 1
1: 0
2: 4
3: 34
4: 286
Right 1154303972 18:13217723-13217745 TCCCCTCTCTCCCCGCGCTGAGG 0: 1
1: 0
2: 1
3: 21
4: 239
1154303969_1154303983 17 Left 1154303969 18:13217703-13217725 CCGGCGGCCGCAGCGCCGCGTCC 0: 1
1: 0
2: 4
3: 34
4: 286
Right 1154303983 18:13217743-13217765 AGGCTGCGGACCGGGCCCGGCGG 0: 1
1: 0
2: 2
3: 36
4: 385
1154303969_1154303986 27 Left 1154303969 18:13217703-13217725 CCGGCGGCCGCAGCGCCGCGTCC 0: 1
1: 0
2: 4
3: 34
4: 286
Right 1154303986 18:13217753-13217775 CCGGGCCCGGCGGGATTAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 79
1154303969_1154303982 14 Left 1154303969 18:13217703-13217725 CCGGCGGCCGCAGCGCCGCGTCC 0: 1
1: 0
2: 4
3: 34
4: 286
Right 1154303982 18:13217740-13217762 CTGAGGCTGCGGACCGGGCCCGG 0: 1
1: 0
2: 1
3: 28
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154303969 Original CRISPR GGACGCGGCGCTGCGGCCGC CGG (reversed) Intronic
900117279 1:1034041-1034063 GGACCCGGCGCGGCCTCCGCAGG + Intronic
900364803 1:2306774-2306796 GTCGGCGGCGCTGCGGCGGCAGG - Exonic
900638741 1:3678339-3678361 GGACGCTGCGCTGGGGCAGGGGG - Intronic
901005470 1:6169768-6169790 GGCTGGGGCGCTGGGGCCGCAGG - Intronic
901109562 1:6784708-6784730 GGACGCGGCGCCGAGGGGGCGGG + Intergenic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
902520253 1:17011762-17011784 GGCCCCGGCGCTGCGGCCCTCGG + Exonic
902793384 1:18784417-18784439 GGGCTCGGCGCCGCGGCCGACGG + Intergenic
902916701 1:19644143-19644165 GGAGGGGGCGCCGCGGCGGCAGG - Intronic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
903072199 1:20732053-20732075 AGGCGCGGGGCTGCGGCGGCGGG - Intronic
903750177 1:25616686-25616708 GGCTGCGGCGCGGCGGCGGCGGG + Intergenic
903925130 1:26826612-26826634 GGAGGGGGCGCTGCGGCGGGAGG + Intergenic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
905995874 1:42380528-42380550 GGACGTGGCGCTGCGGGCTGGGG - Intergenic
908186035 1:61654246-61654268 CGACGATGCGCTGCGGCAGCTGG + Intergenic
910221474 1:84893173-84893195 GGACGCGTCGCAGGGGTCGCTGG - Intronic
910963394 1:92784885-92784907 AGACGCGGCGGCGCGGCTGCCGG - Intronic
910981303 1:92961762-92961784 GGAGGGGGCGCCGCGGCAGCGGG + Intergenic
914937523 1:151993755-151993777 GGCCGAGGCGCGGCGGACGCTGG + Exonic
916676329 1:167066810-167066832 GGACCCGGTGCTCCGGCCTCTGG - Intronic
920418414 1:205813469-205813491 CGACGCGGCGCAGCGGGCCCGGG - Intronic
924763117 1:247007621-247007643 AGACGCGGCGCTGCGGGCGCGGG + Intronic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
924801420 1:247331712-247331734 GGAGGCGGCGCCGCGGAGGCCGG + Exonic
1062843779 10:689671-689693 GGAGGCGGCGGCGCGGGCGCGGG + Intronic
1063636465 10:7787733-7787755 GGACGCGGGGCTGAGGGCGCGGG - Intronic
1063929950 10:11018439-11018461 GGACGCCGCGCTCGGCCCGCTGG - Intronic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065342825 10:24723176-24723198 CGCCGCCGCGCTTCGGCCGCCGG - Intronic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1070257642 10:74825554-74825576 GAGCGCGGCGCTGCGGACCCGGG + Intergenic
1070768402 10:79069216-79069238 GGACGCGCCGCCGCCACCGCCGG - Exonic
1070948016 10:80408904-80408926 GGACCCGGCGCTGCTGCGGCGGG + Intronic
1071966588 10:90858087-90858109 GGACGCGGCGCGGCTGCCGCAGG - Intergenic
1072757558 10:98030836-98030858 CGGCGCGGCGCGGCGGCCACTGG + Intergenic
1072915483 10:99535283-99535305 CCACGCGGCGCGGCGGCGGCGGG - Exonic
1074843227 10:117375258-117375280 GAAAGCGGCGCTGTGGGCGCGGG - Exonic
1076157027 10:128212089-128212111 GGGCGCGCGTCTGCGGCCGCGGG + Intergenic
1076825414 10:132964831-132964853 GGAGGTGGCGCAGCAGCCGCTGG - Intergenic
1077010360 11:376735-376757 GCACGCGGCGCTGGGGCCCGGGG - Exonic
1078771753 11:14358582-14358604 GAGCGCGACGCTGCGGCCGCAGG + Intronic
1080406908 11:31987583-31987605 GGGCGCGGGGCTGGGGGCGCTGG + Intronic
1081981423 11:47269588-47269610 GGCCGCGCCGCGGCGCCCGCTGG - Intronic
1082789261 11:57335837-57335859 GGACGCGGGGCCGCGCACGCGGG - Exonic
1083160807 11:60853011-60853033 GGCCGCGGTGCTGCAACCGCAGG + Exonic
1083669497 11:64292138-64292160 CGGCGCGGCGCTGCAGCCTCGGG + Intronic
1083939569 11:65888426-65888448 GCTCGGGGCGCTGCGGCCCCGGG - Exonic
1085266671 11:75241541-75241563 GGACGCTGCGCTGGCACCGCTGG + Exonic
1085641578 11:78196323-78196345 GGAGGCGGCGCGGCAGCCGCTGG + Exonic
1088522141 11:110711936-110711958 GGAGGCGGCGGCGCTGCCGCTGG + Intronic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1089243068 11:117098267-117098289 GGACGCGGCTGGCCGGCCGCAGG + Exonic
1089596557 11:119584560-119584582 GGACGTGGAGCTGCGGTCGTTGG - Intergenic
1090264567 11:125345978-125346000 GGACGCGGCGTTGGGGCTGAGGG + Intronic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1092999340 12:13980795-13980817 GGAGGCGGCGCTGCTGCTGGAGG - Intergenic
1095049132 12:37541539-37541561 GGCCGCGGCTGTGCGGCGGCAGG - Intergenic
1095998004 12:48105826-48105848 GGTGGCCGCGCTGTGGCCGCCGG - Intronic
1096191539 12:49623360-49623382 GGACGCGGCGGCGCGGGGGCGGG + Intronic
1097871971 12:64610006-64610028 GGACTGGGCGTTGCGGCTGCAGG + Intergenic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1103649636 12:122422629-122422651 TGACGCGCCGCCGCCGCCGCGGG + Intronic
1104841629 12:131828592-131828614 GGGCGCGGCGCAGCCCCCGCGGG - Exonic
1104860318 12:131920037-131920059 GGAAGAAGCGCTGCAGCCGCAGG - Exonic
1105411858 13:20177527-20177549 GGAGGCGGCGCGGTGGCCGCGGG - Intergenic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1106956362 13:34942771-34942793 AGCAGCGGCGCTGCCGCCGCCGG - Exonic
1110706025 13:78602503-78602525 GGACGAGACGCTGCTGGCGCGGG - Exonic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1113587423 13:111474883-111474905 GGACGCGGAGCTGCTGCTGAGGG + Intergenic
1113679515 13:112233460-112233482 GGACGCTGCGCTGGGACCTCCGG + Intergenic
1113768441 13:112894613-112894635 GGACGCTGGGCAGGGGCCGCGGG - Intronic
1113981842 13:114282436-114282458 GGACGGGGCGCTGCGGGGCCGGG + Intronic
1114555858 14:23562005-23562027 GGACGTGGAGCTGCAGCAGCGGG - Exonic
1114558511 14:23576021-23576043 GCGGGCGGCGCTGCGGCCGGGGG + Exonic
1114957843 14:27845790-27845812 GGATCCCGCGCTGGGGCCGCTGG - Intergenic
1116945195 14:50830305-50830327 GGAAGCGGAGGTGCGGCCGCAGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122162385 14:99793627-99793649 GGCCGAGGCCCGGCGGCCGCGGG + Intronic
1122418215 14:101560494-101560516 GGGCGCGGGGCAGCGGGCGCGGG - Intergenic
1122418403 14:101561075-101561097 CGGCGCGGCTCGGCGGCCGCCGG + Intergenic
1122517663 14:102319954-102319976 GGACGCGGCGCGGCGGCTGCGGG + Exonic
1122635323 14:103127042-103127064 GGAGGCGGCGCGGCCGCTGCTGG + Exonic
1122886640 14:104713269-104713291 GGAGGAGGCGCGGCGGCCTCGGG + Exonic
1122892406 14:104738886-104738908 GGACGCTGAGCTGCAGCCTCAGG + Intronic
1122904476 14:104795533-104795555 GGATGCGGAGCGGCGGGCGCCGG - Intronic
1124426893 15:29570429-29570451 GGGCTAGGCGCTGCGGCCGCCGG - Intronic
1128374584 15:67065980-67066002 GGCCGCGGCGCTGCAGCCTGCGG - Exonic
1129144333 15:73633365-73633387 GGCCTGGGCGCTGCGGCGGCAGG - Exonic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131466043 15:92655567-92655589 GGACTCGGCTCTGCTGGCGCGGG + Exonic
1132551297 16:554865-554887 GGCCCTGGGGCTGCGGCCGCAGG - Intergenic
1132591169 16:727080-727102 GGAGGCGGGGCCTCGGCCGCCGG - Intronic
1132662040 16:1065942-1065964 GGACCCGCCGCCGCGGCCGCAGG - Intergenic
1132759111 16:1500403-1500425 TGACGTGGCGCTGCTGCGGCAGG - Exonic
1132885067 16:2178939-2178961 GGCCGCGGCGCTGCAGGCGGTGG - Exonic
1133046363 16:3090487-3090509 GGACGGGGCGCTGCGGCTAGCGG - Exonic
1133058595 16:3159976-3159998 GGACGCGCCGCTGCGACCTCAGG - Intergenic
1134069969 16:11254965-11254987 GCACGCGGCGCTGGCGCAGCGGG + Exonic
1134104606 16:11476853-11476875 GCTGGCGGCGCTGCGGACGCTGG + Exonic
1135565854 16:23510418-23510440 AGCCCCGACGCTGCGGCCGCGGG + Exonic
1138352067 16:56351371-56351393 GCATGCGGTTCTGCGGCCGCAGG - Intronic
1138450643 16:57092131-57092153 GGGAGCGGCGCTGCGCCCTCGGG - Intergenic
1141418996 16:83899495-83899517 GGAGGCGGCGGTGCTGCTGCAGG + Exonic
1142053379 16:87975357-87975379 GGACGTGGGGCTGAGGCTGCAGG - Intronic
1142120096 16:88382963-88382985 GGACGCCGGCCGGCGGCCGCGGG - Intergenic
1142192980 16:88726348-88726370 AGACGCGGCGCTGCAGCAGCAGG + Exonic
1142400922 16:89858435-89858457 GCACGCGGGGCCGCGGGCGCTGG - Exonic
1144971295 17:19111316-19111338 GGGTGCGCCGCTGCGGCCACCGG - Intergenic
1144991600 17:19237487-19237509 GGGTGCGCCGCTGCGGCCACCGG - Exonic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1146271540 17:31488545-31488567 GGCAGGGGCGCTGCGGCCGGAGG - Intronic
1147158612 17:38558312-38558334 GGAGGCGGCGCGGCGGCAGGAGG - Exonic
1147179502 17:38675098-38675120 GGACCCGGCGCGGCGGCGGCTGG + Exonic
1147264087 17:39224829-39224851 GGACGCGAGGCCGCGGCCGGGGG - Intronic
1147675497 17:42202402-42202424 GTACGTGGCGCTGCCGCCCCCGG + Exonic
1147971128 17:44219547-44219569 GGAGGAGCCGCTGCCGCCGCGGG - Intronic
1148493470 17:48037819-48037841 GGAGGCGGGGCGGCGGCGGCGGG - Intronic
1151801659 17:76383007-76383029 GACCGCGGCACTGCGGCTGCAGG + Intronic
1151801732 17:76383289-76383311 GCGCGCGGAGCTGCGGCCCCAGG + Intronic
1152110076 17:78353050-78353072 GGCCGCGGCGATGCGGGCCCGGG + Intergenic
1152193193 17:78901022-78901044 GGACGTGGCGCTGTGCCTGCCGG - Intronic
1152809473 17:82374771-82374793 CGCTGCGGTGCTGCGGCCGCTGG + Exonic
1152856039 17:82664862-82664884 TGCCGCGGGGCTGTGGCCGCTGG + Intronic
1153285154 18:3449995-3450017 GGGGGCGGCGGTGCGGACGCGGG - Intronic
1153515271 18:5895725-5895747 GCACGGGGCGCTCGGGCCGCGGG + Intronic
1154246302 18:12702679-12702701 TGACGCGGCGTTGCGTCCCCCGG - Exonic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1155519851 18:26656923-26656945 AGCCGCGGCGGAGCGGCCGCGGG + Intronic
1160025432 18:75211798-75211820 GGACGCGGGGCCCCGGGCGCGGG - Intronic
1160204651 18:76822732-76822754 GGATGCGGCGCGGGGGGCGCCGG + Intronic
1160592353 18:79951580-79951602 GGGCGCGGGGCTGGGGGCGCAGG - Exonic
1160788701 19:913052-913074 GGGCGGGGCGCGGCGGGCGCCGG - Intronic
1160914094 19:1488474-1488496 AGACGCGTCGTTGCTGCCGCGGG + Intronic
1161077067 19:2290969-2290991 GGCCGCCGCGCTGCGGCACCAGG - Exonic
1161346379 19:3770668-3770690 GGAGGCGTCCCTGCGGCTGCTGG - Exonic
1161510853 19:4670247-4670269 GGCCGTGGCGCTGAGGCCGGCGG - Exonic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1163019239 19:14473801-14473823 GGCCGTGGCGCTGCTGCCGCTGG - Exonic
1163033694 19:14560125-14560147 GGACGCCGGGCTGCGGCAGGAGG - Intronic
1163111126 19:15161402-15161424 GAAGGCGGGGCTGGGGCCGCAGG - Exonic
1163159726 19:15457473-15457495 GCCCGCAGCGCTGCGCCCGCCGG + Exonic
1163321538 19:16577538-16577560 TGAGGCGGCGCTGCGGGGGCTGG - Exonic
1163462636 19:17448252-17448274 GGCCGGGACGCTGCTGCCGCTGG - Exonic
1164990079 19:32676578-32676600 GCACGCGCCGCGGCGGCCGCTGG + Exonic
1165080065 19:33301940-33301962 GGCGCCGGCGCTGCGGCCGCTGG - Exonic
1165129175 19:33621702-33621724 GGGCGCGGTCCGGCGGCCGCGGG - Intergenic
1165242839 19:34481645-34481667 GGAGACGGCGCTGCGGCCTCTGG - Exonic
1165595296 19:37007717-37007739 GGTGGCGGCGCGGCGGCCTCGGG - Intergenic
1165867895 19:38950107-38950129 GCCCTCGGCGCTGCGGTCGCGGG + Exonic
1166042953 19:40214169-40214191 GGACGGGGCGCTGGGGCAGCGGG + Exonic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167295446 19:48646563-48646585 GGAAGGGGGGCTGCGGGCGCTGG - Intergenic
1167797545 19:51719640-51719662 GGCGGCGGCGCGGGGGCCGCTGG - Exonic
1168239496 19:55082054-55082076 GGGCGCGGCGATGGGGACGCGGG - Intronic
1168266057 19:55224677-55224699 GGACACGACGCTGGGGCTGCTGG + Intergenic
1168332534 19:55578682-55578704 GGACGCGGCGGTGCTGGCGGAGG + Exonic
1168594516 19:57664504-57664526 AGACCCGGGGCTGCGGCTGCAGG + Intergenic
926095750 2:10080001-10080023 GGACGAGACGCTGCGCCTGCTGG - Exonic
926155000 2:10448603-10448625 GGGCGGGGCGAGGCGGCCGCAGG - Intergenic
927519752 2:23691616-23691638 GGAAGCGGCACGGTGGCCGCAGG + Intronic
927714203 2:25341864-25341886 GGACGCGGCGCCGCGGCACCAGG - Intronic
928303504 2:30147242-30147264 GGCCCCGGCGCTGGGACCGCGGG + Intronic
929983136 2:46699302-46699324 GGAAGCGACGCTGCGCTCGCTGG + Intronic
931253780 2:60553850-60553872 GGAGGGGGCGCTGGGGCCGCGGG + Intergenic
931602593 2:64019213-64019235 GGAGGCGGCGCTGCGGACCCGGG - Intergenic
932562730 2:72887370-72887392 GCAGGAGGCGGTGCGGCCGCGGG - Exonic
934479460 2:94622144-94622166 GGATCCCGCGCTGGGGCCGCTGG + Intergenic
934933208 2:98445107-98445129 GGAGGCGACGCGGCCGCCGCGGG + Intronic
935137651 2:100321814-100321836 GCTCGGGGCGCTGCGGCCGGAGG - Exonic
935149065 2:100417509-100417531 GGCCGCGGCGCGGAGGCCTCGGG - Exonic
935255718 2:101308265-101308287 GGGCGCGGCCCCTCGGCCGCCGG + Exonic
935265111 2:101387193-101387215 GGACGCGCACCTGCGGCCCCGGG - Exonic
937271266 2:120654555-120654577 GGACGCGGCGGTGGGGCAGGGGG + Intergenic
938397856 2:130963973-130963995 GGCGGCGGTGCGGCGGCCGCGGG - Intronic
939898989 2:147827276-147827298 TGATCCTGCGCTGCGGCCGCAGG - Intergenic
940883642 2:158969771-158969793 AAACGCGGCGCTGCGGCCAAGGG + Intronic
942454635 2:176129654-176129676 GGGCGCGGCGCTCCGTCCGTCGG + Intergenic
942565888 2:177264549-177264571 GGACTTGGAGCTGCCGCCGCCGG - Exonic
943060666 2:183038532-183038554 GGACGGGGAACTGCGGCCGACGG + Exonic
943470760 2:188291893-188291915 GGACGCGGGGCTGGGGACTCCGG - Intronic
945664149 2:212721013-212721035 GGATCCTGCGCTGGGGCCGCAGG + Intergenic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
1170150510 20:13221732-13221754 GGACCCGGCGCGGCGGCCGGCGG - Intergenic
1172446804 20:34997451-34997473 GGAGGCGGCGCTGCGGCACGAGG + Exonic
1173685240 20:44918939-44918961 GGAGGCGGAGCTGGGGGCGCGGG + Exonic
1174317450 20:49713727-49713749 GGACGGGGAGCTGCGGGAGCAGG - Exonic
1175981284 20:62739961-62739983 GGACGAGGCGGTGCGGCCAGGGG - Intronic
1176005745 20:62861565-62861587 GGACGCGGCGCTGGGCGAGCCGG - Exonic
1176448173 21:6840082-6840104 GCTCGAGGCGCTGCGGCCGGAGG + Intergenic
1176826343 21:13705104-13705126 GCTCGAGGCGCTGCGGCCGGAGG + Intergenic
1177549174 21:22598211-22598233 GGATCCTGCGCTGGGGCCGCAGG - Intergenic
1178922488 21:36747786-36747808 GGACGGGGCGCGGCTGGCGCTGG + Exonic
1179495173 21:41766826-41766848 GGGCGGGGCGCTGGGGCGGCTGG - Intronic
1180259913 21:46662024-46662046 GGACGCGGCGTGGCGGTCGTGGG + Intronic
1180650019 22:17369698-17369720 GGCTGCGGCGCTGCCGCGGCGGG + Exonic
1180791518 22:18577785-18577807 GGCGGCGGCGCTCCGCCCGCCGG + Intergenic
1180837259 22:18936140-18936162 GGCCACGGCAGTGCGGCCGCCGG - Exonic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1181006587 22:20016538-20016560 GGACCCGGGGCTGGGGCCTCGGG - Intronic
1181230222 22:21417526-21417548 GGCGGCGGCGCTCCGCCCGCCGG - Intronic
1181248427 22:21517337-21517359 GGCGGCGGCGCTCCGCCCGCCGG + Intergenic
1182236944 22:28883601-28883623 GGCCGCGGCGCGACGGCCGGGGG + Exonic
1182805779 22:33068900-33068922 GGACTCAGGGCTGCGGCTGCTGG + Intergenic
1183261429 22:36798236-36798258 GGCCCCTGCGCTGCGGCTGCAGG - Intergenic
1183517050 22:38272767-38272789 GGACGCCCGGCTTCGGCCGCCGG - Intronic
1183713340 22:39519739-39519761 CGACACGGCGCTGCTGCCCCCGG - Intronic
1184035258 22:41915001-41915023 GGAGGCCGCGCCGGGGCCGCGGG + Intergenic
1184152985 22:42649264-42649286 GGAGGGGGCGCCGGGGCCGCGGG - Intronic
1184276555 22:43412173-43412195 GGGCGGGGCGCGGCGGGCGCGGG + Intronic
1184767077 22:46577513-46577535 GAACCCGGACCTGCGGCCGCAGG - Intronic
1185398546 22:50604557-50604579 GGTCGAGGCGCGGCGGGCGCGGG - Exonic
1203287352 22_KI270734v1_random:161439-161461 GGCCACGGCAGTGCGGCCGCCGG - Intergenic
949987811 3:9553640-9553662 GCGCGCGAGGCTGCGGCCGCGGG + Intronic
950902999 3:16513711-16513733 GGACGCGCGGCGGCGGCGGCGGG - Intronic
952867228 3:37862120-37862142 GGGCGCGGCGCGGGGGGCGCGGG - Intronic
956678301 3:71754774-71754796 GGACGGCGGGCTTCGGCCGCGGG + Exonic
961116509 3:124334453-124334475 AGACGCAGAGCTGCAGCCGCTGG - Exonic
961329655 3:126131054-126131076 GGATGCAGGGCTGAGGCCGCAGG - Intronic
961545313 3:127629181-127629203 CGCCGCGCCGCTGCGGCTGCAGG + Exonic
962808925 3:138945863-138945885 GGAGGCGGGGGTGCGGCCGGCGG + Exonic
963236842 3:142964028-142964050 GGGCGGGGAGCTGCGGCTGCGGG + Intergenic
966355100 3:179071613-179071635 GGACGCGGCGCGGAGACTGCCGG - Exonic
966849323 3:184155226-184155248 GGCCGCGGCGCTCCGGTCCCGGG - Intronic
966913005 3:184569617-184569639 GGACCAGGGGCTGCGGCAGCGGG + Intronic
966936327 3:184711987-184712009 GCTGGCGGCGTTGCGGCCGCAGG - Exonic
967685276 3:192409903-192409925 GGAGGCGGCGGCGCGGCGGCGGG - Intronic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968701322 4:2059462-2059484 GGACGCGGCCGGGCGGCGGCGGG - Intergenic
968702731 4:2064511-2064533 GGCAGTGGCGCTGGGGCCGCAGG - Exonic
968815176 4:2818243-2818265 GGCCGCGGAGCTGGGGCCGGCGG + Exonic
969256918 4:6008439-6008461 GGACGAGGCACTGGGGCAGCAGG - Intergenic
969445855 4:7244397-7244419 GAACGCGGCGCTGCTCCTGCAGG + Intronic
971244146 4:24913124-24913146 GGTCGCGGGGCTGAGGGCGCGGG - Intronic
971757606 4:30722132-30722154 GAACACGCTGCTGCGGCCGCCGG - Exonic
975701986 4:77075674-77075696 GGACGCACGGCTGCGGCCGCTGG + Exonic
977257576 4:94758026-94758048 GACCGCGGCGCTGAGGACGCGGG + Intronic
978503650 4:109434132-109434154 GGGCGCGGTGCGGAGGCCGCGGG + Intronic
979455644 4:120922860-120922882 GGCCTGGGCGCTGCGGGCGCCGG + Intronic
981280674 4:142954678-142954700 GGATCCTGCGCTGGGGCCGCGGG - Intergenic
981617359 4:146655457-146655479 GGCCGCGGCGGAGCGGCCGGCGG - Intergenic
984823666 4:183906005-183906027 TGACGAGGCGCTGCAGTCGCGGG + Exonic
985628956 5:1005035-1005057 GGAGGAGGAGGTGCGGCCGCAGG - Intergenic
987050443 5:14143666-14143688 GCACGCGGCGCTAGGGGCGCGGG + Intergenic
987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG + Exonic
988578003 5:32444839-32444861 GGCCTCGGCGGTGCGGGCGCGGG + Intergenic
988734655 5:34008112-34008134 GGGCGCGGCGCCGCGGCTGGGGG - Intronic
990347448 5:54884128-54884150 GGACGCGGGGCCGCCGCGGCGGG - Intergenic
992940074 5:81751950-81751972 GCAGGGGCCGCTGCGGCCGCAGG - Intergenic
995764704 5:115602428-115602450 GGACGTGGCGCTGCGGGCCGGGG + Exonic
996948164 5:129094697-129094719 GGAGGCGGGGCCGCGGCAGCCGG + Intergenic
997470648 5:134115184-134115206 CGGCGCGGCGCGGCGACCGCGGG - Intronic
997485290 5:134226016-134226038 GGAGGAGGCGCAGCGGCCGACGG - Exonic
998658129 5:144205230-144205252 GGACGCCGCGCTCCGGCGGTGGG - Intronic
999462697 5:151771067-151771089 GGGCGCTGCGAGGCGGCCGCGGG - Intronic
1001601360 5:172930928-172930950 GGACTGGGCTCTGCGGCTGCAGG + Intronic
1001960722 5:175878987-175879009 GCAGGAGGCGCTGCGGCAGCAGG + Exonic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002055832 5:176597478-176597500 GGCGGGGGCGCTGCGGCCTCTGG + Exonic
1002140404 5:177134087-177134109 GCCGGCGGCGCTGCAGCCGCCGG + Intronic
1002401729 5:178994890-178994912 GCTCGTGGCGCTGCTGCCGCTGG - Exonic
1002622022 5:180494647-180494669 GGTGGCGGCGCTGCAGCAGCGGG + Exonic
1002927249 6:1611577-1611599 GGCGGCGGCGCGGGGGCCGCGGG + Exonic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1005600792 6:27424770-27424792 GGACCCCGCGCTGGGGCTGCAGG + Intergenic
1007581146 6:42960880-42960902 GTACTCGGCGGTGCGGCTGCGGG - Exonic
1011470230 6:87701424-87701446 GGACCCGGCCCCGCGGCCGCCGG - Intronic
1013232414 6:108169797-108169819 GCGCGCGGCGCGGCGGCCACCGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1018876641 6:167827269-167827291 GGGCGCGGCGCAGCGGGCGGGGG - Intronic
1019279562 7:193017-193039 GGACCCAGCGCTCCGGCGGCGGG + Exonic
1020099932 7:5388986-5389008 GAATGCGGCGCTGCAGCCGTCGG - Exonic
1021716831 7:23469236-23469258 TGGCGCGGGGCTGCGGCCTCCGG - Intronic
1022396021 7:29989118-29989140 GGACACGGTGCGGCGGCCGCGGG + Intronic
1026858377 7:73769524-73769546 GGCCGCGGCGCTGCAGCTGCTGG - Exonic
1028762427 7:94510256-94510278 GGAGGCGGCGACGCGGCGGCTGG + Intronic
1028841540 7:95434758-95434780 GGACCTGGCCCTGCGGCCGGGGG - Intronic
1033253162 7:139777752-139777774 GGAGGCGGTGATGCGGGCGCGGG - Intronic
1033654300 7:143362608-143362630 GGGCCCGGCTCTGCGGCCCCCGG - Exonic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1035676496 8:1460114-1460136 GGACTCGGTTCTGCGGCCCCGGG + Intergenic
1035751859 8:2002083-2002105 GGCCGCGGCGCTCGGGCCGGCGG + Exonic
1037725140 8:21477143-21477165 GCAGGCTGCGCTGCAGCCGCTGG + Intergenic
1038543981 8:28411912-28411934 GGACGCCGGGCTGAAGCCGCGGG - Intronic
1039463159 8:37762737-37762759 GGCTGTGGCGCGGCGGCCGCGGG + Exonic
1041275897 8:56157275-56157297 GAAAGCGGCGCAGCGGACGCGGG + Intergenic
1043463707 8:80486040-80486062 GGGGGCGGGGGTGCGGCCGCGGG - Intronic
1043502944 8:80874263-80874285 CGGGGCGGCGCGGCGGCCGCGGG + Intronic
1049419555 8:142510786-142510808 GGGCGCGCGGCTGCGGGCGCAGG + Intronic
1049680634 8:143916428-143916450 GGGCACGGGGCTGCGGCTGCTGG - Exonic
1049680983 8:143918084-143918106 GGCCACGGCGCTGCAGCTGCGGG - Exonic
1049718207 8:144103660-144103682 GCACGCCGCGGTGAGGCCGCTGG - Exonic
1049766638 8:144358211-144358233 GGCCGCGGCGCTGGGGCCCCGGG + Exonic
1050094254 9:2047330-2047352 GGCCCGGGCACTGCGGCCGCGGG - Exonic
1050437842 9:5628883-5628905 GGACGCAACCCGGCGGCCGCGGG + Intergenic
1053493150 9:38526785-38526807 CGCCGCGTCGCTGCGGCCACTGG - Intergenic
1053928352 9:43089780-43089802 GGATCCCGCGCTGGGGCCGCTGG - Intergenic
1054506251 9:65914859-65914881 AGATCCGGCGCTGGGGCCGCTGG + Intergenic
1057208078 9:93184981-93185003 GGGCGCGGCGCGGGGCCCGCGGG + Exonic
1057494959 9:95553501-95553523 GGCCGCGGCGGGGCGGCGGCTGG - Intergenic
1057881565 9:98796404-98796426 GGAGACGGCGCGGCGGCTGCTGG - Exonic
1057883103 9:98807959-98807981 GGGCGAGGAGCTGCGGCTGCAGG + Exonic
1057934016 9:99221771-99221793 GGACGCGGCGCTGGCGCTGCAGG - Exonic
1058885392 9:109319131-109319153 GCACCCGGCGCTGCGGCAGACGG - Intronic
1059633932 9:116154327-116154349 CGGCGAGGCGCGGCGGCCGCGGG - Exonic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061129848 9:128702746-128702768 GGAGGCGGCGCTGGTCCCGCGGG + Exonic
1061181710 9:129028331-129028353 GGGCGGGGCGCGGAGGCCGCGGG + Intergenic
1061610031 9:131740002-131740024 GGAGGCGGAGCGGCGGCGGCGGG - Intronic
1061967694 9:134025449-134025471 AGACACGGCCCAGCGGCCGCCGG + Intergenic
1062579254 9:137222280-137222302 GGGGGTGGCGCTGCGGGCGCGGG - Intergenic
1203521018 Un_GL000213v1:44436-44458 GCTCGAGGCGCTGCGGCCGGAGG - Intergenic
1185621794 X:1454233-1454255 GGGCGCGGTGCTGGGGGCGCAGG + Intergenic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1190024574 X:46912223-46912245 GAACGCGGCGCCGCGGGTGCGGG + Intergenic
1190266964 X:48832315-48832337 AGACGCTGCGCTTAGGCCGCGGG + Exonic
1197782444 X:130171686-130171708 GGCCGAGGCGCGGCGGCGGCTGG + Exonic
1198099960 X:133415010-133415032 GGAAGCGGCGCTACGGCAGCGGG + Exonic