ID: 1154307589

View in Genome Browser
Species Human (GRCh38)
Location 18:13241780-13241802
Sequence CACAGGGACATGCGTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 577}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154307583_1154307589 3 Left 1154307583 18:13241754-13241776 CCGCTGAACAGCCTGGATCCTGC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307576_1154307589 17 Left 1154307576 18:13241740-13241762 CCGCGGTCCCCTCCCCGCTGAAC 0: 1
1: 0
2: 1
3: 13
4: 195
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307574_1154307589 19 Left 1154307574 18:13241738-13241760 CCCCGCGGTCCCCTCCCCGCTGA 0: 1
1: 0
2: 0
3: 12
4: 240
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307573_1154307589 26 Left 1154307573 18:13241731-13241753 CCTCTGTCCCCGCGGTCCCCTCC 0: 1
1: 0
2: 3
3: 74
4: 556
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307577_1154307589 10 Left 1154307577 18:13241747-13241769 CCCCTCCCCGCTGAACAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 243
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307580_1154307589 8 Left 1154307580 18:13241749-13241771 CCTCCCCGCTGAACAGCCTGGAT 0: 1
1: 0
2: 0
3: 14
4: 84
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307586_1154307589 -8 Left 1154307586 18:13241765-13241787 CCTGGATCCTGCTTTCACAGGGA 0: 1
1: 0
2: 4
3: 24
4: 183
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307582_1154307589 4 Left 1154307582 18:13241753-13241775 CCCGCTGAACAGCCTGGATCCTG 0: 1
1: 0
2: 3
3: 36
4: 445
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307572_1154307589 29 Left 1154307572 18:13241728-13241750 CCTCCTCTGTCCCCGCGGTCCCC 0: 1
1: 0
2: 0
3: 54
4: 430
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307581_1154307589 5 Left 1154307581 18:13241752-13241774 CCCCGCTGAACAGCCTGGATCCT 0: 1
1: 0
2: 1
3: 11
4: 91
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307575_1154307589 18 Left 1154307575 18:13241739-13241761 CCCGCGGTCCCCTCCCCGCTGAA 0: 1
1: 0
2: 0
3: 3
4: 136
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577
1154307579_1154307589 9 Left 1154307579 18:13241748-13241770 CCCTCCCCGCTGAACAGCCTGGA 0: 1
1: 0
2: 3
3: 10
4: 155
Right 1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154307589 Original CRISPR CACAGGGACATGCGTGAAAT GGG Intronic
900076959 1:825696-825718 CACAGGGTCATGGGTGAGAATGG + Intergenic
900164939 1:1240798-1240820 CAGATGGACATGCCAGAAATGGG - Intergenic
900828948 1:4950217-4950239 CACAGGGACATGGATGAAGTGGG + Intergenic
902471591 1:16650174-16650196 CACAGAGACACGCGTGAAGACGG - Intergenic
902487218 1:16757271-16757293 CACAGAGACACGCGTGAAGACGG + Intronic
902687609 1:18089084-18089106 CACAAGGAAGTGCATGAAATGGG + Intergenic
904408416 1:30309856-30309878 TATAGGGACATGGATGAAATTGG + Intergenic
906898010 1:49800660-49800682 TATAGGGACATGGATGAAATTGG - Intronic
907107242 1:51894958-51894980 TGCAGGGACATGCATGAAGTTGG + Intergenic
907711594 1:56887829-56887851 TGCAGGGACATGGGTGAAACTGG + Intronic
908220436 1:62000492-62000514 TGCAGGGACATGGATGAAATTGG - Intronic
908630771 1:66104233-66104255 TGCAGGGACATGGATGAAATTGG - Intronic
908907818 1:69037055-69037077 TGCAGGGACATGGATGAAATTGG + Intergenic
910156860 1:84229226-84229248 CGTAGGGACATGGATGAAATTGG - Intronic
910664029 1:89705119-89705141 TATAGGGACATGGATGAAATTGG + Intronic
911355008 1:96806098-96806120 CACAGGGAAAAGGATGAAATGGG - Intronic
911413718 1:97543948-97543970 CAGAGGGAAATGGGTGAAGTGGG + Intronic
911807583 1:102231161-102231183 CGTAGGGACATGGATGAAATTGG + Intergenic
911873683 1:103132011-103132033 CACAGTGACCTGGATGAAATTGG - Intergenic
912649557 1:111425686-111425708 CATAGGGACATGCGCGAGTTTGG - Intronic
913152409 1:116057753-116057775 TGTAGGGACATGGGTGAAATTGG + Intronic
913160116 1:116137819-116137841 TGTAGGGACATGGGTGAAATTGG + Intergenic
913434934 1:118837268-118837290 TATAGGGACATGGATGAAATTGG + Intergenic
913935652 1:125041497-125041519 CGTAGGGACATGGATGAAATTGG - Intergenic
913941372 1:125110858-125110880 TATAGGGACATGGATGAAATTGG - Intergenic
914979508 1:152400496-152400518 TGTAGGGACATGGGTGAAATTGG - Intergenic
914982972 1:152431506-152431528 TGCAGGGACATGGATGAAATTGG - Intergenic
915794082 1:158708352-158708374 AACAGGGACATGGATGAAACTGG - Intergenic
915858244 1:159413535-159413557 TGCAGGGACATGGATGAAATGGG + Intergenic
916402575 1:164464936-164464958 TGTAGGGACATGGGTGAAATTGG + Intergenic
916696390 1:167241207-167241229 CAAAGGGAGATGTGTAAAATAGG - Intronic
916874458 1:168953988-168954010 TGCAGGGACATGGATGAAATTGG - Intergenic
916979224 1:170115607-170115629 CACAGCGACATGCCTGAGACAGG - Intergenic
917230309 1:172829494-172829516 CACAGGGACATGGATGAAGCTGG - Intergenic
917385045 1:174463358-174463380 TATAGGGACATGGATGAAATTGG + Intronic
917749400 1:178040655-178040677 CACATGGACGTGCATGACATTGG + Intergenic
918080154 1:181201429-181201451 TGCAGGGACATGGATGAAATTGG + Intergenic
918320317 1:183358114-183358136 TGCAGGGACATGGATGAAATTGG + Intronic
918567158 1:185948273-185948295 CACATGGACACGCATGAAATGGG - Intronic
918680906 1:187351753-187351775 AAAAGGGACATGTGTGAAAATGG + Intergenic
918836109 1:189469029-189469051 CGTAGGGACATGGATGAAATTGG - Intergenic
918856348 1:189760637-189760659 TGCAGGGACATGGATGAAATTGG + Intergenic
918887881 1:190220238-190220260 TACAGGGACATGGGTGAAGCTGG + Intronic
919093352 1:192999660-192999682 TACAGGGACATGGATGAAACTGG + Intergenic
919194951 1:194272295-194272317 TATAGGGACATGGATGAAATTGG - Intergenic
920359188 1:205400991-205401013 TGTAGGGACATGGGTGAAATTGG - Intronic
921319352 1:213923267-213923289 TATAGGGACATGGATGAAATTGG + Intergenic
922655338 1:227377477-227377499 CACAGGCACAGGAATGAAATTGG - Intergenic
922848699 1:228712506-228712528 TGTAGGGACATGCATGAAATTGG + Intergenic
923598702 1:235382109-235382131 TATAGGGACATGGATGAAATTGG - Intronic
923717411 1:236436874-236436896 GGCAGAGACCTGCGTGAAATAGG + Intronic
924241562 1:242045856-242045878 TATAGGGACATGGATGAAATTGG - Intergenic
924869474 1:248025795-248025817 TGTAGGGACATGGGTGAAATTGG + Intronic
924884677 1:248201740-248201762 TATAGGGACATGGATGAAATTGG - Intergenic
1062985104 10:1761344-1761366 CACAGGGATAGGCATGAAAAAGG - Intergenic
1063838249 10:10041277-10041299 CACAGCGACATGGATGAGATTGG + Intergenic
1064218139 10:13417603-13417625 CACAGGGGCAGGAGTGAAACAGG + Intergenic
1064714949 10:18167141-18167163 CACAGCGACATGAGTGGAACTGG + Intronic
1064866337 10:19884648-19884670 CGTAGGGACATGGATGAAATTGG - Intronic
1064890455 10:20165573-20165595 CACAGGGACATGGATGAAATTGG - Intronic
1065438978 10:25729746-25729768 TGCAGGGACATGGATGAAATGGG + Intergenic
1067245841 10:44542413-44542435 TGCAGGGACATGGATGAAATTGG - Intergenic
1067786297 10:49251321-49251343 TATAGGGACATGGATGAAATTGG + Intergenic
1068155926 10:53198612-53198634 CGTAGGGACATGGATGAAATTGG - Intergenic
1068363907 10:56018670-56018692 CACAGGCAGAAGAGTGAAATTGG + Intergenic
1068940131 10:62672510-62672532 TGCAGGGACATGGATGAAATTGG - Intergenic
1069345887 10:67469453-67469475 CACAGGGACATGGATGAAGCTGG + Intronic
1070206771 10:74271707-74271729 TATAGGGACATGGATGAAATTGG - Intronic
1072834996 10:98701336-98701358 CGTAGGGACATGGATGAAATTGG + Intronic
1073733396 10:106318356-106318378 TACAGGGACATGGATGAAACTGG - Intergenic
1073888226 10:108066394-108066416 TGCAGGGACATGGATGAAATTGG - Intergenic
1073978721 10:109129977-109129999 TGCAGGGACATGGATGAAATTGG + Intergenic
1074718123 10:116238964-116238986 CACACTGAAATACGTGAAATAGG + Intronic
1075303268 10:121344551-121344573 TATAGGGACATGGATGAAATTGG - Intergenic
1075866561 10:125726880-125726902 CACTGGGAGATGGGTGACATGGG - Intronic
1076069643 10:127477367-127477389 CACAGGGACATGGATGAAGCTGG - Intergenic
1076212150 10:128657525-128657547 GACAGGGACATGGGAGGAATCGG - Intergenic
1076892580 10:133292111-133292133 CACGGGGACATGGGGGACATGGG - Intronic
1077672705 11:4170538-4170560 TGCAGGGACATGGATGAAATTGG - Intergenic
1077862094 11:6191059-6191081 TGCAGGGACATGGATGAAATTGG + Intergenic
1078410791 11:11115518-11115540 CACAGAGACATACCTGAAACTGG - Intergenic
1079037015 11:17028794-17028816 TGCAGGGACATGGATGAAATTGG - Intergenic
1080082121 11:28234099-28234121 TGTAGGGACATGCATGAAATTGG - Intronic
1080535312 11:33215787-33215809 TACAGGGACATGGATGAAATTGG - Intergenic
1081017473 11:37900821-37900843 TATAGGGACATGGATGAAATTGG - Intergenic
1081504090 11:43696857-43696879 TACAGGGACATGGATGAAACTGG + Intronic
1081511274 11:43775903-43775925 CGTAGGGACATGGATGAAATTGG - Intronic
1082122516 11:48394439-48394461 TATAGGGACATGGATGAAATTGG + Intergenic
1082131700 11:48497946-48497968 TCCAGGGACATGGATGAAATTGG + Intergenic
1082249814 11:49965677-49965699 CGCAGGGACATGGATGAAACTGG + Intergenic
1082256746 11:50040819-50040841 TGTAGGGACATGGGTGAAATTGG + Intergenic
1082596680 11:55090216-55090238 TGTAGGGACATGGGTGAAATTGG + Intergenic
1082743359 11:56935856-56935878 TATAGGGACATGGATGAAATTGG - Intergenic
1082882648 11:58053294-58053316 TGCAGGGACATGGATGAAATTGG + Intronic
1083019661 11:59493910-59493932 TGCAGGGACATGGATGAAATTGG + Intergenic
1084564047 11:69919635-69919657 CACATGAACATGAGTGCAATGGG + Intergenic
1084722215 11:70914231-70914253 CACAGGAACAAGTGTGCAATGGG + Intronic
1085345078 11:75763427-75763449 CACAGGGACCTGGGTGATATTGG - Intronic
1085828723 11:79876538-79876560 TGCAGGGACATGGATGAAATTGG - Intergenic
1086664348 11:89461004-89461026 TGTAGGGACATGGGTGAAATTGG + Intronic
1086810923 11:91309137-91309159 CGTAGGGACATGAATGAAATTGG - Intergenic
1086883385 11:92175260-92175282 TATAGGGACATGGATGAAATTGG + Intergenic
1087312556 11:96561423-96561445 TGTAGGGACATGGGTGAAATTGG + Intergenic
1087473385 11:98604960-98604982 TGTAGGGACATGGGTGAAATTGG + Intergenic
1088312979 11:108479747-108479769 TACAGAGACATGATTGAAATAGG - Intronic
1088730598 11:112678849-112678871 CGTAGGGACATGGATGAAATTGG - Intergenic
1089457796 11:118635302-118635324 CACAGGGGCATGCGTTGTATGGG - Intronic
1090117329 11:123987401-123987423 TGTAGGGACATGGGTGAAATTGG + Intergenic
1090188956 11:124756123-124756145 CACAGGGACTGGGGTGAAAAGGG - Intronic
1090603730 11:128399619-128399641 CACAGGGCCATGTGTGAAAGTGG - Intergenic
1091052832 11:132389248-132389270 CACAGGGACATGGATGAAGCTGG + Intergenic
1091231797 11:133992703-133992725 CCCAGGGACATGGATGAAACTGG + Intergenic
1092176490 12:6411665-6411687 CACAGGAAGATAGGTGAAATGGG - Intergenic
1094037176 12:26083890-26083912 CGCAGGGACATGCATGAAGCTGG + Intergenic
1094859522 12:34446328-34446350 TATAGGGACATGGATGAAATTGG - Intergenic
1095069512 12:37823668-37823690 TGTAGGGACATGGGTGAAATCGG - Intergenic
1095076160 12:37928887-37928909 TATAGGGACATGGATGAAATTGG + Intergenic
1095593181 12:43928889-43928911 TATAGGGACATGGATGAAATTGG - Intronic
1095615246 12:44180648-44180670 TGTAGGGACATGGGTGAAATTGG - Intronic
1095677570 12:44937537-44937559 TGTAGGGACATGCATGAAATTGG + Intergenic
1096923089 12:55110911-55110933 TGCAGGGACATGGATGAAATTGG - Intergenic
1097300860 12:58017440-58017462 CACAGGGACATGGATGAAGCTGG - Intergenic
1097841924 12:64329821-64329843 TATAGGGACATGGATGAAATTGG - Intronic
1098193083 12:67971338-67971360 TGCAGGGACATGGATGAAATTGG - Intergenic
1098295153 12:68996877-68996899 TGCAGGGACATGGATGAAATTGG + Intergenic
1098303890 12:69082485-69082507 TGCAGGGACATGGATGAAATTGG + Intergenic
1099276743 12:80586029-80586051 TGTAGGGACATGGGTGAAATTGG - Intronic
1099403136 12:82224786-82224808 TGTAGGGACATGGGTGAAATTGG + Intronic
1099492580 12:83305565-83305587 TGCAGGGACATGGGTGAAGTTGG + Intergenic
1099631292 12:85148445-85148467 TGCAGGGACATGGGTGAAACTGG - Intronic
1100584593 12:95968447-95968469 CACAGGGGCCTTCCTGAAATGGG + Exonic
1101243449 12:102861677-102861699 TATAGGGACATGGGTGAAACTGG + Intronic
1102778733 12:115544456-115544478 CACAAGTACATGCTTTAAATTGG + Intergenic
1105227844 13:18453199-18453221 CGTAGGGACATGGATGAAATTGG - Intergenic
1105251637 13:18703972-18703994 CACATGGACACGCGTGACAAAGG + Intergenic
1105980968 13:25515791-25515813 CATAGAGACATGAGTTAAATAGG - Intronic
1106771366 13:32963853-32963875 TATAGGGACATGGATGAAATTGG + Intergenic
1107107016 13:36654815-36654837 TGCAGGGACATGGGTGAAACTGG - Intergenic
1107163278 13:37256066-37256088 CGTAGGGACATGGATGAAATTGG + Intergenic
1107489250 13:40864867-40864889 CATAGGGACATGGATGAAATTGG - Intergenic
1108198306 13:48017487-48017509 CATAGGGACATGGATGAAACTGG + Intergenic
1108248444 13:48541092-48541114 TACAGGGACATGGATGAAACTGG + Intergenic
1108763611 13:53600070-53600092 TGTAGGGACATGGGTGAAATTGG + Intergenic
1108998688 13:56767446-56767468 TACAGGGACATGGATGAAACTGG - Intergenic
1109584645 13:64383185-64383207 CACAGGGACATGGATGAAGCTGG - Intergenic
1109601309 13:64633361-64633383 CATAGGGACATGGATGAAATTGG + Intergenic
1109615933 13:64833858-64833880 CAAAGGGACATGGATGAAGTTGG + Intergenic
1109663150 13:65492161-65492183 TACAGGGACATGGGTGAAGCTGG + Intergenic
1110813478 13:79836672-79836694 TGCAGGGACATGGGTGAAACTGG + Intergenic
1111096425 13:83521900-83521922 CGTAGGGACATGGATGAAATTGG - Intergenic
1113022199 13:105899886-105899908 CACAGGTAAATGTGTGTAATGGG - Intergenic
1113540074 13:111100449-111100471 CACAGGGACCTGTGTAAGATTGG + Intergenic
1114139985 14:19898541-19898563 TATAGGGACATGGATGAAATTGG - Intergenic
1114770357 14:25423871-25423893 TGCAGGGACATGGATGAAATCGG - Intergenic
1114956229 14:27822906-27822928 CACAGGGACACGGATGAAGTAGG + Intergenic
1115367996 14:32580847-32580869 TGCAGGGACATGGATGAAATTGG - Intronic
1115719306 14:36142952-36142974 TGTAGGGACATGGGTGAAATTGG - Intergenic
1116137625 14:40949207-40949229 CGTAGGGACATGGATGAAATTGG - Intergenic
1116805799 14:49493087-49493109 CACAGTGAAATGCTTGTAATTGG + Intergenic
1117044049 14:51794897-51794919 TGTAGGGACATGGGTGAAATTGG - Intergenic
1118731967 14:68674729-68674751 CACAGGGGTATGTGTGTAATGGG + Intronic
1119144403 14:72297718-72297740 TCCAGGGACATGGATGAAATTGG + Intronic
1120371829 14:83645014-83645036 TGCAGGGACATGGATGAAATTGG + Intergenic
1120586516 14:86318063-86318085 TATAGGGACATGGATGAAATTGG + Intergenic
1120719199 14:87872123-87872145 CACAGGGATATCCGTGGGATAGG + Intronic
1120909944 14:89657134-89657156 CACAGGCACATGTGTGAAACAGG + Intergenic
1121899505 14:97680544-97680566 TGCAGGGACATGGGTGAAAGTGG + Intergenic
1123221717 14:106863626-106863648 TGTAGGGACATGGGTGAAATTGG - Intergenic
1124016291 15:25878831-25878853 CACAGGGACATGGATGAAGCTGG + Intergenic
1124483827 15:30099333-30099355 TGCAGGGACATGGATGAAATTGG + Intergenic
1124519752 15:30397893-30397915 TGCAGGGACATGGATGAAATTGG - Intergenic
1124538901 15:30568328-30568350 TGCAGGGACATGGATGAAATTGG + Intergenic
1124759748 15:32439242-32439264 TGCAGGGACATGGATGAAATTGG - Intergenic
1124869034 15:33522344-33522366 CACAGAAACATGCTTGAAAGGGG - Intronic
1125218202 15:37303572-37303594 TGCAGGGACATGAATGAAATTGG - Intergenic
1125224959 15:37385603-37385625 TATAGGGACATGGATGAAATTGG - Intergenic
1125423045 15:39523826-39523848 CGTAGGGACATGGATGAAATTGG + Intergenic
1126123708 15:45276176-45276198 TGCAGGGACATGGATGAAATTGG + Exonic
1126537140 15:49778805-49778827 TGCAGGGACATGGATGAAATTGG - Intergenic
1126765655 15:52008693-52008715 CACAGGGCCCTGCGTGCAAAAGG - Intronic
1127195013 15:56574920-56574942 TGCAGGGACATGGATGAAATTGG - Intergenic
1127521643 15:59748884-59748906 CACAGGGACATGGATGAAGCTGG + Intergenic
1127761553 15:62144752-62144774 TGTAGGGACATGGGTGAAATTGG + Intergenic
1128693571 15:69743888-69743910 CACAGGGACAAACGTGGAAGGGG + Intergenic
1128960538 15:71998873-71998895 TGTAGGGACATGGGTGAAATTGG - Intronic
1129572657 15:76705244-76705266 TGTAGGGACATGGGTGAAATTGG + Intronic
1129768803 15:78189517-78189539 TGTAGGGACATGGGTGAAATGGG + Intronic
1129939848 15:79486079-79486101 TATAGGGACATGGATGAAATTGG - Intergenic
1131625687 15:94118078-94118100 TGCAGGGACATGGATGAAATTGG + Intergenic
1132260746 15:100422781-100422803 TGCAGGGACATGGATGAAATTGG + Intronic
1133499837 16:6355429-6355451 TGCAGGGACATGCGTGAAGCTGG - Intronic
1133642362 16:7729600-7729622 TGCAGGGACATGGATGAAATTGG + Intergenic
1133912443 16:10078425-10078447 CACAAGGACATGCTGGAAAGAGG - Intronic
1134132361 16:11658403-11658425 CACAGGGTGATGCCTGTAATTGG - Intergenic
1137079587 16:36029577-36029599 TGTAGGAACATGCGTGAAATTGG + Intergenic
1137763975 16:50963410-50963432 CACAGGAACAAACATGAAATAGG - Intergenic
1137797111 16:51230961-51230983 TACAGGGACATGGGTGAATCTGG + Intergenic
1137868226 16:51923509-51923531 TGCAGGGACATGGGTGAAACTGG - Intergenic
1138015156 16:53421286-53421308 CACAGGGAAATGCAGGCAATCGG - Intergenic
1140694946 16:77523611-77523633 TGTAGGGACATGGGTGAAATTGG + Intergenic
1141037544 16:80641593-80641615 CGTAGGGACATGCATGAAACTGG + Intronic
1145829140 17:27900961-27900983 TGTAGGGACATGGGTGAAATTGG - Intergenic
1146148064 17:30439703-30439725 TGCAGGGACATGGATGAAATTGG - Intronic
1149229203 17:54513450-54513472 TGCAGGGACATGGGTGAAACTGG - Intergenic
1150016815 17:61565424-61565446 CGCAGGGACATACGTGAAGCTGG + Intergenic
1150210330 17:63438104-63438126 CACGGGGACAGGCGTGACCTGGG + Intronic
1150876364 17:68975148-68975170 CACAGGGACATGGATGAAGCTGG - Exonic
1153114127 18:1633869-1633891 TGTAGGGACATGCATGAAATTGG + Intergenic
1153359262 18:4174906-4174928 CACAGGGACATGGATGAAGCTGG - Intronic
1154016904 18:10626953-10626975 CACAGGCACATGCTTGAACCTGG - Intergenic
1154188603 18:12208691-12208713 CACAGGCACATGCTTGAACCTGG + Intergenic
1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG + Intronic
1154469332 18:14683394-14683416 TGCAGGGACATGGATGAAATTGG - Intergenic
1154756271 18:18504945-18504967 TGCAGGGACATGGATGAAATTGG + Intergenic
1155671307 18:28375063-28375085 CACAGAGTTATGCCTGAAATAGG + Intergenic
1155697339 18:28698444-28698466 CACACGGACTTGAGTGAATTTGG - Intergenic
1155730409 18:29150902-29150924 TATAGGGACATGGATGAAATTGG - Intergenic
1156419440 18:36934605-36934627 CAAATGGACATGGATGAAATTGG - Intronic
1157933228 18:51845948-51845970 CACAGCGACCTGGATGAAATTGG - Intergenic
1158664258 18:59418295-59418317 AAAAGTGACATGGGTGAAATGGG - Intergenic
1159209243 18:65295375-65295397 CGTAGGGACATGGATGAAATTGG - Intergenic
1159311970 18:66720791-66720813 CGTAGGGACATGGATGAAATTGG + Intergenic
1159329360 18:66970162-66970184 CACAGGGACATGGATGAAGCTGG - Intergenic
1159900898 18:74044668-74044690 TGTAGGGACATGGGTGAAATTGG + Intergenic
1160922990 19:1529340-1529362 CCCAGGGACAGGCGTGAGGTGGG - Intronic
1160971180 19:1768448-1768470 CACCGGGACATGCCTGAAGGGGG + Intronic
1161860231 19:6792433-6792455 CTTAGGGACTTGCGTGAATTAGG + Intronic
1162736856 19:12751788-12751810 CACAGGGACAGGGATGGAATGGG - Exonic
1162891976 19:13740152-13740174 TGCAGGGACATGCATGAAACTGG + Intronic
1163426371 19:17243105-17243127 CACAGGGACATGCCAGAATGTGG - Intronic
1164352927 19:27374891-27374913 TATAGGGACATGGATGAAATTGG - Intergenic
1165260817 19:34615983-34616005 TATAGGGACATGGATGAAATTGG - Intronic
1165474698 19:36023845-36023867 CACCGGGAAATGAGTGAAATTGG + Intronic
1166489098 19:43242349-43242371 TGCAGGGACATGGATGAAATTGG - Intronic
1166591002 19:43998318-43998340 CACAGACACAAGGGTGAAATTGG - Intronic
1168052145 19:53837332-53837354 CACACGGACGCGCATGAAATGGG + Intergenic
1168157571 19:54484707-54484729 CACAGGGACCAACGTGAAATTGG + Intergenic
1168207614 19:54863150-54863172 TGCAGGGACATGGATGAAATTGG - Intronic
925094078 2:1180914-1180936 TATAGGGACATGGATGAAATTGG + Intronic
925167413 2:1726274-1726296 TATAGGGACATGGATGAAATTGG + Intronic
925915484 2:8601458-8601480 TGCAGGGACATGGGTGAAGTTGG + Intergenic
926522575 2:13933871-13933893 TGCAGGGACATGGATGAAATTGG + Intergenic
928736759 2:34300435-34300457 TGCAGGGACATGTGTGAAACTGG + Intergenic
930352436 2:50274222-50274244 CACAGGGACATGGATGAAGCTGG + Intronic
930405828 2:50954482-50954504 AACAGGGACATGCAGGAATTAGG + Intronic
931280695 2:60789023-60789045 CGTAGGGACATGGATGAAATTGG + Intronic
931952789 2:67383747-67383769 TGTAGGGACATGGGTGAAATTGG + Intergenic
933308059 2:80627008-80627030 TACAGGGACATGGTTGAAGTTGG - Intronic
933330055 2:80881976-80881998 CGTAGGGACATGGATGAAATTGG - Intergenic
934509028 2:94922071-94922093 CACAGGAACATGGGGGAAGTAGG + Intergenic
934632710 2:95946754-95946776 TGTAGGGACATGGGTGAAATTGG + Intronic
934693924 2:96384814-96384836 TGTAGGGACATGGGTGAAATTGG + Intergenic
934800793 2:97156515-97156537 TGTAGGGACATGGGTGAAATTGG - Intronic
935509176 2:103949949-103949971 TATAGGGACATGGATGAAATTGG + Intergenic
935613261 2:105048198-105048220 TGCAGGGACATGGATGAAATTGG + Intronic
935937601 2:108203435-108203457 TATAGGGACATGGATGAAATTGG - Intergenic
936620902 2:114096590-114096612 TATAGGGACATGGATGAAATTGG - Intergenic
936991279 2:118369358-118369380 CACACGGACATGCAAGAAAGTGG - Intergenic
937445402 2:121953210-121953232 CACAGGGACATGGATGGAACTGG - Intergenic
937893422 2:126957910-126957932 TACAGGGACATGGGTGAAGCTGG - Intergenic
938326857 2:130412770-130412792 TGCAGGGACATGGGTGAAACTGG + Intergenic
938363087 2:130708689-130708711 TGCAGGGACATGGGTGAAACTGG - Intergenic
939139100 2:138331989-138332011 CACAGTGACCTGGATGAAATTGG - Intergenic
940615487 2:156044067-156044089 CACATGGACATGGGGGAAGTGGG - Intergenic
940654423 2:156470701-156470723 CTCAGGGACTTACATGAAATAGG + Intronic
940689795 2:156901621-156901643 GAAAAGGACATGCTTGAAATTGG + Intergenic
941326635 2:164123306-164123328 TATAGGGACATGGATGAAATTGG + Intergenic
941763492 2:169270452-169270474 TACAGGGACATGGATGAAATTGG + Intronic
942010266 2:171755222-171755244 TGCAGGGACATGGGTGAAGTTGG - Intergenic
942739320 2:179156034-179156056 CACAGCGACCTGCATGAAATTGG - Intronic
943392562 2:187287949-187287971 CGCAGGGACATGGATGAAATTGG - Intergenic
943450685 2:188039125-188039147 CACAGGGACGTGAGTAAAAATGG + Intergenic
943873490 2:193032805-193032827 TATAGGGACATGGATGAAATTGG - Intergenic
945823234 2:214689488-214689510 TATAGGGACATGAATGAAATTGG + Intergenic
947028982 2:225771053-225771075 CACTGGGACAAGCATAAAATAGG - Intergenic
947207885 2:227679057-227679079 TGTAGGGACATGGGTGAAATTGG + Intergenic
948967729 2:241397030-241397052 TGTAGGGACATGGGTGAAATTGG + Intronic
1169936289 20:10887070-10887092 TACAGGGACATGGGTGAAGCTGG - Intergenic
1170187407 20:13606303-13606325 AACAGAGACATGAATGAAATGGG - Intronic
1171510906 20:25684049-25684071 TACAGGGACATGGATGAAGTTGG + Intronic
1171805105 20:29671294-29671316 TGCAGGGACATGGATGAAATTGG - Intergenic
1171826188 20:29909764-29909786 TGCAGGGACATGGATGAAATTGG - Intergenic
1171829688 20:29978183-29978205 TGCAGGGACATGGATGAAATTGG + Intergenic
1171832384 20:30030450-30030472 TGCAGGGACATGGATGAAATTGG - Intergenic
1171877447 20:30591657-30591679 TGCAGGGACATGGATGAAATTGG - Intergenic
1173771262 20:45660711-45660733 TGTAGGGACATGGGTGAAATTGG - Intronic
1174849459 20:53978195-53978217 TATAGGGACATGGATGAAATTGG + Intronic
1174932711 20:54833185-54833207 CACAGGGACATCCATGAAGTGGG - Intergenic
1175511654 20:59532075-59532097 TGCAGGGACATGGATGAAATTGG - Intergenic
1175590437 20:60185752-60185774 TGCAGGGACATGGATGAAATCGG - Intergenic
1175940284 20:62534650-62534672 CACCGGGACAGTCGGGAAATGGG - Intergenic
1176703538 21:10089864-10089886 TGCAGGGACATGAATGAAATTGG + Intergenic
1176837164 21:13803859-13803881 CACATGGACATGCGTGACAAAGG + Intergenic
1176988406 21:15464659-15464681 CACAGGGACATGGATGAAGCTGG + Intergenic
1177062572 21:16393605-16393627 TATAGGGACATGGATGAAATTGG - Intergenic
1177478928 21:21660787-21660809 TGTAGGGACATGGGTGAAATTGG - Intergenic
1179015801 21:37593715-37593737 AATAGGTAAATGCGTGAAATTGG + Intergenic
1180400129 22:12409457-12409479 CGTAGGGACATGGATGAAATTGG - Intergenic
1180964191 22:19777355-19777377 CATAGGGACATGGATGAAACTGG - Intronic
1181994375 22:26863720-26863742 CACAGGGACATGGATGAACCTGG - Intergenic
1183695321 22:39418617-39418639 CACATGGAAATACCTGAAATGGG - Intronic
1184227924 22:43141032-43141054 CACATGGACAGGGGTGACATTGG - Intronic
949407032 3:3725075-3725097 TGTAGGGACATGGGTGAAATTGG + Intronic
949689501 3:6619723-6619745 CACAGGGACATGGGTGCTACTGG + Intergenic
949765849 3:7524961-7524983 TATAGGGACATGGATGAAATTGG + Intronic
950594561 3:13967802-13967824 TATAGGGACATGGATGAAATTGG - Intronic
951234580 3:20219403-20219425 TGCAGGGACATGGATGAAATTGG - Intergenic
951448246 3:22807084-22807106 TGCAGGGACATGGATGAAATTGG + Intergenic
951769453 3:26239375-26239397 TGTAGGGACATGGGTGAAATTGG - Intergenic
953106808 3:39889375-39889397 TATAGGGACATGGATGAAATTGG + Intronic
953288961 3:41642484-41642506 TATAGGGACATGGATGAAATTGG - Intronic
953639700 3:44695032-44695054 TATAGGGACATGGATGAAATTGG + Intergenic
955602465 3:60661347-60661369 CACAGTTACATGGGTGGAATTGG - Intronic
955623875 3:60895778-60895800 CACAGGAACCAGCTTGAAATGGG - Intronic
955919733 3:63943097-63943119 CACAGGGGCCTGCCTTAAATTGG + Intronic
956076845 3:65515005-65515027 TATAGGGACATGGATGAAATTGG + Intronic
956084926 3:65598274-65598296 CACAGGGCCATGCGGGTGATGGG - Intronic
956524637 3:70144220-70144242 CACAGGGACAGGCAGCAAATTGG + Intergenic
956867135 3:73380864-73380886 TATAGGGACATGGATGAAATTGG - Intergenic
957049221 3:75398477-75398499 CACATGGACGTGCATGAAAGTGG + Intergenic
957738313 3:84230538-84230560 TATAGGGACATGGATGAAATTGG - Intergenic
958489295 3:94751179-94751201 CATAGGGACATGGATGAAATTGG + Intergenic
958766748 3:98378243-98378265 TGCAGGGACATGGATGAAATTGG - Intergenic
959215624 3:103447337-103447359 CACAGAGAAAAGCGTGACATAGG + Intergenic
959235056 3:103710233-103710255 TGTAGGGACATGGGTGAAATTGG - Intergenic
959261101 3:104081646-104081668 CACAGTGACATGGATGAAATTGG - Intergenic
960020915 3:112952482-112952504 TGCAGGGACATGGATGAAATTGG + Intronic
960516254 3:118605693-118605715 TGCAGGGACATGGATGAAATTGG - Intergenic
961063855 3:123857493-123857515 TGCAGGGACATGGATGAAATTGG + Intronic
961355509 3:126337272-126337294 TGCAGGGACATGGATGAAATTGG + Intergenic
961852621 3:129836945-129836967 CACAGGGAGATAAGGGAAATAGG - Intronic
962671440 3:137712918-137712940 CACAGGGACATGGATGAAGCTGG + Intergenic
963304384 3:143634916-143634938 TACAGGGAAAGGGGTGAAATAGG + Intronic
964039903 3:152248912-152248934 TGCAGGGACATGGATGAAATTGG - Intronic
964113821 3:153114490-153114512 TGCAGGGACATGGATGAAATTGG + Intergenic
965039325 3:163485805-163485827 CGTAGGGACATGGATGAAATTGG + Intergenic
965159281 3:165110604-165110626 TGTAGGGACATGGGTGAAATTGG + Intergenic
965270852 3:166615495-166615517 CATAGGGACATGGATGAAGTTGG - Intergenic
966279964 3:178214642-178214664 CACACGGACACGAGTGAAAATGG + Intergenic
967288400 3:187895912-187895934 TGCAGGGACATGGATGAAATTGG + Intergenic
967374405 3:188784219-188784241 CACAGTGACCTGGATGAAATTGG - Intronic
968993854 4:3933064-3933086 CACACGGACGTGCATGAAACTGG + Intergenic
970286839 4:14527266-14527288 TACAGGGACATGGATGAAACTGG + Intergenic
970341566 4:15112827-15112849 TGTAGGGACATGGGTGAAATTGG - Intergenic
970524672 4:16919126-16919148 CACGGGGACAGGAGTGAAAGTGG + Intergenic
970548834 4:17158134-17158156 CACAGTGACCTGGATGAAATTGG - Intergenic
970895897 4:21103879-21103901 CGTAGGGACATGGATGAAATTGG - Intronic
971040948 4:22751460-22751482 CACAGGGACATCCATGCAAGTGG + Intergenic
971048837 4:22837332-22837354 CACAGGGAAAAGAATGAAATTGG + Intergenic
971770283 4:30886819-30886841 TGCAGGGACATGGATGAAATTGG + Intronic
972861374 4:43173087-43173109 TGCAGGGACATGGGTGAAACTGG + Intergenic
973040394 4:45462271-45462293 TATAGGGACATGGATGAAATTGG + Intergenic
973098813 4:46235893-46235915 TGTAGGGACATGGGTGAAATTGG - Intergenic
973548471 4:52006397-52006419 TGCAGGGACATGGATGAAATTGG + Intronic
974331159 4:60480839-60480861 TGTAGGGACATGGGTGAAATTGG - Intergenic
974812733 4:66966371-66966393 CGTAGGGACATGGATGAAATTGG - Intergenic
975460971 4:74652404-74652426 TGCAGGGACATGGGTGAAATTGG - Intergenic
975573642 4:75841998-75842020 CACAGGGAAATGTTTGAAATAGG + Intergenic
975902409 4:79168165-79168187 TACAGGGACATGGATGAAACTGG - Intergenic
977193391 4:94028454-94028476 TATAGGGACATGGATGAAATTGG - Intergenic
977205598 4:94161828-94161850 TACAGGGACATGCATGAAGCTGG - Intergenic
977291679 4:95171533-95171555 TGTAGGGACATGGGTGAAATTGG - Intronic
977778935 4:100957332-100957354 TGTAGGGACATGGGTGAAATTGG - Intergenic
978185490 4:105852409-105852431 CACAGGGACATGGATGAAGCTGG - Intronic
978323812 4:107527754-107527776 TGCAGGGACATGGATGAAATTGG + Intergenic
978717723 4:111866239-111866261 CACAGGGACATGGATGAAGTTGG - Intergenic
978766808 4:112412936-112412958 CAAAAGGACATGGGAGAAATGGG + Intronic
979175329 4:117655778-117655800 CGTAGGGACATGGATGAAATTGG - Intergenic
979196676 4:117927679-117927701 CGTAGGGACATGGATGAAATTGG + Intergenic
979214871 4:118151083-118151105 TGTAGGGACATGCATGAAATTGG + Intronic
979634308 4:122939926-122939948 TACAGGGACATGGATGAAACTGG - Intronic
980011028 4:127594645-127594667 TGTAGGGACATGGGTGAAATTGG + Intergenic
980015928 4:127650515-127650537 TGTAGGGACATGGGTGAAATTGG - Intronic
980375756 4:131946220-131946242 TGCAGGGACATGAATGAAATTGG + Intergenic
981109657 4:140920883-140920905 TATAGGGACATGGATGAAATTGG + Intronic
981223045 4:142259050-142259072 TGTAGGGACATGCATGAAATTGG + Intronic
981757559 4:148157001-148157023 TACAGGGACATGGATGAAATTGG + Intronic
982835989 4:160120510-160120532 TGCAGGGACATGGATGAAATTGG - Intergenic
983015671 4:162608869-162608891 CACAGGGACAAGCGAGAGAATGG - Intergenic
983117339 4:163834643-163834665 CTTAGGGACATGGATGAAATTGG + Intronic
983947545 4:173603357-173603379 CGTAGGGACATGGATGAAATTGG - Intergenic
984306667 4:178000730-178000752 TGCAGGGACATGGATGAAATTGG + Intergenic
984716951 4:182934742-182934764 TGTAGGGACATGCATGAAATTGG - Intergenic
985235837 4:187872966-187872988 TGTAGGGACATGGGTGAAATGGG - Intergenic
985307404 4:188558562-188558584 TGCAGGGACATGGATGAAATTGG - Intergenic
985372095 4:189296579-189296601 TGCAGGGACATGAATGAAATTGG - Intergenic
985974669 5:3407577-3407599 TATAGGGACATGGATGAAATTGG - Intergenic
986254654 5:6092135-6092157 CACATGGACAAGCGTGACAGGGG - Intergenic
986797851 5:11230063-11230085 AAAAGGGACATGGATGAAATTGG + Intronic
986971393 5:13341130-13341152 CACAGGGACATGGGTGGAGTTGG - Intergenic
987829236 5:23074540-23074562 CACATGGACCTGAGTGAAACAGG - Intergenic
987880219 5:23734582-23734604 CATAGGGACATGGATGAAACTGG - Intergenic
988178170 5:27754547-27754569 TATAGGGACATGGATGAAATTGG + Intergenic
988210383 5:28196449-28196471 TATAGGGACATGGATGAAATTGG - Intergenic
988971804 5:36476149-36476171 TACAGGGACATGGATGAAACTGG + Intergenic
988979659 5:36553982-36554004 AACAGGGAGATAAGTGAAATTGG - Intergenic
989648391 5:43661705-43661727 CGTAGGGACATGGATGAAATTGG - Intronic
989653936 5:43723660-43723682 TGCAGGGACATGGATGAAATTGG + Intergenic
990129907 5:52568202-52568224 TACAGGGACATGGATGAAGTTGG - Intergenic
990924769 5:61007998-61008020 TGTAGGGACATGCATGAAATTGG + Intronic
990962860 5:61413317-61413339 TATAGGGACATGGATGAAATTGG - Intronic
991169065 5:63599781-63599803 TGTAGGGACATGGGTGAAATTGG - Intergenic
991232999 5:64358929-64358951 TGTAGGGACATGGGTGAAATTGG - Intronic
991243238 5:64482940-64482962 TATAGGGACATGGATGAAATTGG + Intergenic
991326820 5:65442974-65442996 TGCAGGGACATGGATGAAATTGG - Intronic
991756799 5:69881951-69881973 TATAGGGACATGGATGAAATTGG + Intergenic
991836202 5:70757833-70757855 TATAGGGACATGGATGAAATTGG + Intergenic
991884842 5:71252565-71252587 TATAGGGACATGGATGAAATTGG - Intergenic
992393591 5:76351538-76351560 CAAAGAGACAAGCATGAAATTGG + Intronic
992830340 5:80587675-80587697 CACAGGGGCAGCAGTGAAATTGG + Intergenic
993554326 5:89316712-89316734 CACAGGGACATGGATGAAGCAGG - Intergenic
993762684 5:91815829-91815851 CTCAGGAACATGGGTAAAATTGG - Intergenic
993780015 5:92054840-92054862 TATAGGGACATGGATGAAATTGG + Intergenic
994248944 5:97514208-97514230 TGTAGGGACATGCATGAAATTGG - Intergenic
994321149 5:98396374-98396396 TGTAGGGACATGGGTGAAATTGG + Intergenic
994349103 5:98724060-98724082 TGCAGGGACATGGATGAAATTGG + Intergenic
994350578 5:98741970-98741992 CACAGGGCCAGGCATAAAATAGG + Intergenic
994776352 5:104039745-104039767 CACACGGACGTGAGTGAAACTGG - Intergenic
995069897 5:107908141-107908163 CGTAGGGACATGGATGAAATTGG + Intronic
995293832 5:110494061-110494083 AGCAGGGACATGGGTGAAACTGG - Intronic
995363917 5:111332374-111332396 TGCAGGGACATGGATGAAATTGG - Intronic
995771959 5:115680386-115680408 CGTAGGGACATGGATGAAATTGG + Intergenic
996427391 5:123329644-123329666 CACAGGGACATGGATGAAGCTGG - Intergenic
996530952 5:124526313-124526335 TGCAGGGACATGGATGAAATTGG + Intergenic
996725936 5:126673464-126673486 CACACGGACACGCATGAAACAGG + Intergenic
997055234 5:130435163-130435185 TGCAGGGACATGGATGAAATTGG - Intergenic
997920471 5:137974305-137974327 TGCAGGGACATGGATGAAATTGG + Intronic
998734753 5:145124078-145124100 CACAGTGACCTGCATGAGATTGG - Intergenic
998916221 5:147014582-147014604 TGCAGGGACATGGATGAAATTGG + Intronic
998918330 5:147040503-147040525 CATAGGGTCATGCTTGAGATTGG + Intronic
998988951 5:147793581-147793603 TGCAGGGACATGGATGAAATTGG - Intergenic
999114560 5:149151265-149151287 CACAGGGACACCCGTCACATTGG + Intronic
1001345845 5:170897704-170897726 CACAGGGACATGGATGAAGCTGG - Intronic
1002881230 6:1254339-1254361 TATAGGGACATGCGTCATATTGG - Intergenic
1003813978 6:9816460-9816482 TGTAGGGACATGGGTGAAATTGG + Intronic
1003818494 6:9868099-9868121 TACAGGGACATGGATGAAGTTGG - Intronic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1004760629 6:18662208-18662230 TGCAGGGACATGGGTGAAGTTGG + Intergenic
1005359847 6:25021484-25021506 CACAGTGACCTGGGTGAGATTGG + Intronic
1005545290 6:26861589-26861611 TATAGGGACATGGATGAAATTGG - Intergenic
1006607772 6:35271181-35271203 TAGATGGACATGCGTGAAAATGG - Intronic
1008089086 6:47275350-47275372 TACAGGGACATGGATGAAGTTGG + Intronic
1009064694 6:58444996-58445018 TGTAGGGACATGGGTGAAATTGG - Intergenic
1009279419 6:61728133-61728155 TGCAGGGACATGGATGAAATTGG + Intronic
1009328345 6:62382731-62382753 TGCAGGGACATGGATGAAATTGG - Intergenic
1009483952 6:64196590-64196612 TATAGGGACATGGATGAAATTGG + Intronic
1009522839 6:64706265-64706287 CACACGTAGATGCGTGAAACTGG + Intronic
1009759393 6:67983784-67983806 TATAGGGACATGGATGAAATTGG - Intergenic
1009987635 6:70800811-70800833 CACAGGGACATGGATGAAGCTGG - Intronic
1009999997 6:70939593-70939615 TGCAGGGACATGGATGAAATTGG + Intronic
1010000196 6:70941059-70941081 TACAGGGACAAGAGTTAAATAGG - Intronic
1010001075 6:70949900-70949922 TGCAGGGACATGGATGAAATTGG + Intronic
1010319605 6:74490520-74490542 TATAGGGACATGGATGAAATTGG + Intergenic
1010337422 6:74703246-74703268 CATAGGGACATGGATGAAATTGG + Intergenic
1010513476 6:76745944-76745966 TATAGGGACATGGATGAAATTGG - Intergenic
1010633279 6:78226525-78226547 TATAGGGACATGGATGAAATTGG - Intergenic
1011766682 6:90627803-90627825 TGCAGGGACATGGATGAAATTGG + Intergenic
1012504174 6:99926129-99926151 TATAGGGACATGGATGAAATTGG - Intronic
1012786232 6:103630840-103630862 TATAGGGACATGGATGAAATTGG + Intergenic
1012877320 6:104743008-104743030 CGTAGGGACATGGATGAAATTGG + Intronic
1014113893 6:117651374-117651396 CACAGGGACATGGGTAAAGCTGG + Intergenic
1015713999 6:136171932-136171954 TGTAGGGACATGGGTGAAATTGG - Intronic
1016184489 6:141182357-141182379 TGTAGGGACATGGGTGAAATTGG + Intergenic
1016238782 6:141902752-141902774 TGCAGGGACATGCATGAAGTTGG - Intergenic
1016338006 6:143029537-143029559 TACAGGGACATGAATGAAAGTGG - Intergenic
1016535263 6:145103180-145103202 CACAGGGGCGTGCATGAAAATGG - Intergenic
1018201124 6:161396731-161396753 CACAGGCACATGGGACAAATTGG - Intronic
1018670785 6:166175330-166175352 TGCAGGGACATGGATGAAATTGG + Intergenic
1018733892 6:166673144-166673166 CACAGGCACATACGTGACACAGG - Intronic
1018810715 6:167295964-167295986 TGCAGGGACATGGGTGCAATGGG + Intronic
1020633287 7:10666773-10666795 TGCAGGGACATGCATGAAGTTGG - Intergenic
1021224015 7:18007019-18007041 TTGAGGGACATGGGTGAAATTGG - Intergenic
1021905923 7:25332987-25333009 CACAGGCCCATGCTTGAAAATGG - Intergenic
1022903910 7:34837493-34837515 CAATGGGCCATGGGTGAAATGGG - Intronic
1023480001 7:40624026-40624048 CAAATGGACATGCGTTAAACAGG + Intronic
1024021751 7:45377806-45377828 TGCAGGGACATGGATGAAATTGG - Intergenic
1024314882 7:48006629-48006651 CACAGTGACAAGGATGAAATGGG + Intronic
1024778849 7:52822311-52822333 CACAGAGAGATGTCTGAAATTGG - Intergenic
1025311356 7:57946102-57946124 TATAGGGACATGGATGAAATTGG + Intergenic
1025521213 7:61732064-61732086 CATAGGGACATGGATGAAACTGG + Intergenic
1026597609 7:71747116-71747138 TATAGGGACATGGATGAAATTGG + Intergenic
1027639794 7:80718827-80718849 CGTAGGGACATGGATGAAATTGG + Intergenic
1027837637 7:83265431-83265453 TGCAGGGACATGGGTGAAGTTGG + Intergenic
1028011990 7:85657225-85657247 TGCAGGGACATGGATGAAATTGG - Intergenic
1028497340 7:91476966-91476988 TATAGGGACATGGATGAAATTGG - Intergenic
1028508430 7:91595487-91595509 TGCAGGGACATGGATGAAATTGG + Intergenic
1029052406 7:97702595-97702617 TATAGGGACATGGATGAAATTGG + Intergenic
1029249912 7:99228607-99228629 TGCAGGGACATGGATGAAATTGG + Intergenic
1029943655 7:104508305-104508327 TGCAGGGACATGGATGAAATTGG + Intronic
1030363130 7:108616292-108616314 TGCAGGGACATGGATGAAATTGG + Intergenic
1030519817 7:110584673-110584695 TGTAGGGACATGGGTGAAATTGG + Intergenic
1031504958 7:122570729-122570751 TATAGGGACATGGATGAAATTGG + Intronic
1031650002 7:124276832-124276854 CTCAGGCACATGCTTGATATGGG + Intergenic
1032882811 7:136107712-136107734 TGCAGGGACATGGTTGAAATTGG - Intergenic
1033402330 7:141038292-141038314 TGCAGGGACATGGATGAAATTGG + Intergenic
1033932832 7:146545636-146545658 CACAGGGACATGGATGAAGCTGG - Intronic
1034360561 7:150493599-150493621 TGTAGGGACATGGGTGAAATTGG - Intergenic
1034692360 7:153023912-153023934 TGTAGGGACATGGGTGAAATTGG + Intergenic
1035564802 8:634588-634610 CACAGTGCCATGCGTGCAGTAGG + Intronic
1035858950 8:3007617-3007639 CGTAGGGACATGGATGAAATTGG + Intronic
1035906611 8:3517517-3517539 CCCAGGGACTTGTGTGACATTGG - Intronic
1036916542 8:12809618-12809640 TATAGGGACATGGATGAAATTGG + Intergenic
1036989019 8:13570590-13570612 TGTAGGGACATGGGTGAAATTGG - Intergenic
1036995108 8:13646131-13646153 CGTAGGGACATGGATGAAATTGG + Intergenic
1037176812 8:15957122-15957144 TGTAGGGACATGGGTGAAATTGG - Intergenic
1037389771 8:18381065-18381087 GACAGGGACATGGATGAAAACGG + Intergenic
1037692230 8:21191553-21191575 TGCAGGGACATGGATGAAATTGG + Intergenic
1037969483 8:23161761-23161783 TACAGGCACATGTGTGAACTAGG + Intronic
1038103734 8:24410192-24410214 CATAGGGAAATGCGTGTCATGGG + Intergenic
1038116682 8:24563536-24563558 TATAGGGACATGGATGAAATTGG + Intergenic
1039035596 8:33355966-33355988 TATAGGGACATGGATGAAATTGG - Intergenic
1039295591 8:36148570-36148592 CACATGCAGATGAGTGAAATTGG - Intergenic
1039299645 8:36195550-36195572 TGCAGGGACATGGATGAAATTGG - Intergenic
1039317438 8:36388869-36388891 CGTAGGGACATGGATGAAATTGG - Intergenic
1039423558 8:37466078-37466100 TATAGGGACATGGATGAAATTGG + Intergenic
1041410870 8:57553159-57553181 TGCAGGGACATGGATGAAATTGG - Intergenic
1041696303 8:60740503-60740525 CTCAGAGCCATGAGTGAAATTGG + Intronic
1041723314 8:60995858-60995880 TGCAGGGACATGGATGAAATTGG + Intergenic
1042598765 8:70477316-70477338 CACAGGCCCATGTGTAAAATGGG - Intergenic
1042619100 8:70685191-70685213 TGTAGGGACATGGGTGAAATTGG + Intronic
1043719780 8:83533289-83533311 TGCAGGGACATGGATGAAATTGG - Intergenic
1043929664 8:86076169-86076191 TGCAGGGACATGGGTGAAAGTGG - Intronic
1044060598 8:87630524-87630546 TATAGGGACATGGATGAAATTGG + Intergenic
1045409034 8:101897212-101897234 TGCAGGGACATGGATGAAATTGG + Intronic
1045932357 8:107642169-107642191 CACAGGAACATAGGTGAAAAAGG - Intergenic
1046384861 8:113496041-113496063 CAAAGGAACATGATTGAAATTGG + Intergenic
1046425448 8:114042511-114042533 TGTAGGGACATGGGTGAAATTGG - Intergenic
1047669692 8:127132015-127132037 CACAGGGACATGGATGAAGCTGG + Intergenic
1050053605 9:1628958-1628980 TACAGGGACATGGGTGAAGCTGG + Intergenic
1050239021 9:3614340-3614362 AACAGGGACATGGATGGAATGGG - Intergenic
1051336016 9:16066756-16066778 TGCAGGGACATGGATGAAATTGG - Intergenic
1051481855 9:17570124-17570146 CACAGGGACATGGATGAAGCTGG - Intergenic
1051567554 9:18517713-18517735 GATAGGGACATGGATGAAATTGG - Intronic
1051597450 9:18839328-18839350 TGTAGGGACATGCATGAAATTGG - Intronic
1051610974 9:18960978-18961000 CATAGGGACTTGGGTTAAATAGG + Intronic
1052078487 9:24174533-24174555 TATAGGGACATGGATGAAATTGG + Intergenic
1052601405 9:30637059-30637081 TGCAGGGACATGGATGAAATTGG - Intergenic
1052725655 9:32225339-32225361 TGCAGGGACATGGATGAAATTGG - Intergenic
1053041043 9:34872501-34872523 TGTAGGGACATGGGTGAAATTGG - Intergenic
1053765334 9:41388587-41388609 TGCAGGGACATGAATGAAATTGG - Intergenic
1054321488 9:63672868-63672890 TGCAGGGACATGAATGAAATTGG + Intergenic
1054543951 9:66299747-66299769 TGCAGGGACATGAATGAAATTGG - Intergenic
1055194002 9:73564400-73564422 TGCAGGGACATGGATGAAATTGG + Intergenic
1055477333 9:76675761-76675783 TGCAGGGACATGGATGAAATTGG + Intronic
1055810551 9:80143132-80143154 CACACGGACACGCATGAAACTGG + Intergenic
1055882291 9:81015265-81015287 CACACGGACATGAGTGAAACAGG + Intergenic
1056765598 9:89442861-89442883 CACCGGCACATGCGTGAACCAGG - Intronic
1056943454 9:90974774-90974796 CACAGCTACATTTGTGAAATGGG - Intergenic
1058099363 9:100902078-100902100 CACAGGGCCAAGAGTGAAAGTGG - Intergenic
1058354207 9:104063451-104063473 TATAGGGACATGGATGAAATTGG + Intergenic
1202788573 9_KI270719v1_random:59959-59981 TGCAGGGACATGAATGAAATTGG + Intergenic
1186252143 X:7679785-7679807 CGCAGGGACATGGATGAAGTTGG - Intergenic
1186579787 X:10805365-10805387 TATAGGGACATGGATGAAATTGG - Intronic
1188195269 X:27224945-27224967 CATAGGGACATGGATGAAATTGG - Intergenic
1188360320 X:29245070-29245092 CGCAGGGACATGGATGAAACTGG - Intronic
1188718787 X:33498405-33498427 TGTAGGGACATGGGTGAAATTGG + Intergenic
1190188972 X:48259746-48259768 TGCAGGGACATGGATGAAATTGG - Intronic
1190415415 X:50175891-50175913 CATAGGGACATGGATGAAATTGG + Intergenic
1190640261 X:52477562-52477584 TGCAGGGACATGGATGAAATTGG + Intergenic
1190647411 X:52535303-52535325 TGCAGGGACATGGATGAAATTGG - Intergenic
1190945147 X:55085445-55085467 TATAGGGACATGGGTGAAATTGG + Intergenic
1191003005 X:55681450-55681472 GACAGGGACATGGATGAAATTGG - Intergenic
1191075922 X:56453112-56453134 TGCAGGGACATGGATGAAATTGG + Intergenic
1191591806 X:62893924-62893946 TACAGGGACATGGATGAAACTGG + Intergenic
1191651370 X:63541575-63541597 AAAAGGGACATGGATGAAATTGG + Intergenic
1192053615 X:67749196-67749218 AACAGGGAGATGGGTGAAAGCGG + Intergenic
1192088929 X:68132395-68132417 TGCAGGGACATGGATGAAATTGG + Intronic
1192255538 X:69454075-69454097 TGCAGGGACATGGATGAAATTGG + Intergenic
1192532911 X:71904607-71904629 TATAGGGACATGGATGAAATTGG - Intergenic
1192898186 X:75466739-75466761 TACAGGGACATGGGTGGAGTTGG + Intronic
1193026067 X:76847405-76847427 TGCAGGGACATGGATGAAATTGG + Intergenic
1193095564 X:77544712-77544734 TGTAGGGACATGGGTGAAATTGG - Intronic
1193284819 X:79699503-79699525 TGCAGGGACATGGATGAAATTGG + Intergenic
1193403208 X:81070352-81070374 TGCAGGGACATGCGTGCAACTGG + Intergenic
1193495180 X:82202282-82202304 TTCAGGGACATGGATGAAATTGG + Intergenic
1193692920 X:84668967-84668989 TGTAGGGACATGGGTGAAATTGG - Intergenic
1193948301 X:87764953-87764975 TGCAGGGACATGCATGAAACTGG - Intergenic
1194022154 X:88704179-88704201 CACAGGGACATGGATGAATCTGG + Intergenic
1194116553 X:89906145-89906167 TGCAGGAACATGGGTGAAATTGG + Intergenic
1194585987 X:95734955-95734977 TGTAGGGACATGGGTGAAATTGG + Intergenic
1194929180 X:99865806-99865828 TGTAGGGACATGCATGAAATTGG + Intergenic
1195513055 X:105739643-105739665 TGCAGGGACATGGATGAAATTGG - Intronic
1196259939 X:113566913-113566935 TGCAGGGACATGGATGAAATTGG + Intergenic
1196325431 X:114396972-114396994 TGCAGGGACATGGATGAAATTGG + Intergenic
1196584657 X:117416242-117416264 TGCAGGGACATGGGTGAATTTGG - Intergenic
1197087553 X:122496980-122497002 TGTAGGGACATGGGTGAAATTGG - Intergenic
1198219154 X:134583956-134583978 CCCAGGCCCATGCCTGAAATAGG + Intronic
1198930343 X:141851169-141851191 CACAGGGACAATGGTTAAATTGG - Intronic
1199044290 X:143150684-143150706 CACATGTAGATGAGTGAAATGGG + Intergenic
1199324659 X:146483334-146483356 CACAGCAACATGCGTGGAACTGG - Intergenic
1199611469 X:149619797-149619819 TGTAGGGACATGGGTGAAATTGG - Intronic
1200469352 Y:3563328-3563350 TGCAGGAACATGGGTGAAATTGG + Intergenic
1200867046 Y:8055788-8055810 TATAGGGACATGGGTGAAACTGG - Intergenic
1200889301 Y:8305993-8306015 TGCAGGGACATGGATGAAATTGG - Intergenic
1200931217 Y:8698784-8698806 CACATGCACATGCGTGAGGTAGG + Intergenic
1201249776 Y:12045206-12045228 CATAGGGACATGGATGAAATTGG + Intergenic
1201418348 Y:13770999-13771021 TGCAGGGACATGGATGAAATTGG - Intergenic
1201508413 Y:14730719-14730741 TGCAGGGACATGGGTGAAACTGG - Intronic
1201563410 Y:15342259-15342281 TGCAGGGACATGGATGAAATTGG - Intergenic
1201855776 Y:18539685-18539707 CGTAGGGACATGGATGAAATTGG - Intergenic
1201877545 Y:18780700-18780722 CGTAGGGACATGGATGAAATTGG + Intronic
1201919053 Y:19214250-19214272 TATAGGGACATGGATGAAATTGG - Intergenic
1202077151 Y:21048047-21048069 TGCAGGGACATGGATGAAATTGG - Intergenic
1202087724 Y:21156135-21156157 TGCAGGGACATGGATGAAATTGG - Intergenic
1202131471 Y:21615949-21615971 TGCAGGGACATGGATGAAATTGG + Intergenic
1202250013 Y:22860647-22860669 TGTAGGGACATGGGTGAAATTGG + Intergenic
1202403002 Y:24494395-24494417 TGTAGGGACATGGGTGAAATTGG + Intergenic
1202467780 Y:25175688-25175710 TGTAGGGACATGGGTGAAATTGG - Intergenic