ID: 1154308915

View in Genome Browser
Species Human (GRCh38)
Location 18:13252780-13252802
Sequence CTGTGGATGTGGAGGGCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154308915_1154308919 -8 Left 1154308915 18:13252780-13252802 CCGTCGGCCCTCCACATCCACAG 0: 1
1: 0
2: 2
3: 31
4: 233
Right 1154308919 18:13252795-13252817 ATCCACAGCTGTTTCTGCGCAGG 0: 1
1: 1
2: 0
3: 6
4: 106
1154308915_1154308923 19 Left 1154308915 18:13252780-13252802 CCGTCGGCCCTCCACATCCACAG 0: 1
1: 0
2: 2
3: 31
4: 233
Right 1154308923 18:13252822-13252844 TCTGGCTCTGAGCCCTTCTGCGG 0: 1
1: 0
2: 4
3: 37
4: 338
1154308915_1154308920 -7 Left 1154308915 18:13252780-13252802 CCGTCGGCCCTCCACATCCACAG 0: 1
1: 0
2: 2
3: 31
4: 233
Right 1154308920 18:13252796-13252818 TCCACAGCTGTTTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 141
1154308915_1154308922 1 Left 1154308915 18:13252780-13252802 CCGTCGGCCCTCCACATCCACAG 0: 1
1: 0
2: 2
3: 31
4: 233
Right 1154308922 18:13252804-13252826 TGTTTCTGCGCAGGGATGTCTGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154308915 Original CRISPR CTGTGGATGTGGAGGGCCGA CGG (reversed) Intronic
900319224 1:2074306-2074328 CGGTGGCTGTGGAGGGCTGGGGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903819629 1:26092092-26092114 CTGTGCATGTGTAGGGGCCAGGG + Intergenic
903998364 1:27322414-27322436 CTGGGGACGAGGAGGGCCCAGGG + Intronic
904348727 1:29891164-29891186 GTGTGGAGGTGGAGGGCTGTGGG + Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905365498 1:37449047-37449069 CTGAGAATGTGGAGGGGCGGGGG - Intergenic
906783659 1:48595445-48595467 CTGTGGCTGTGCCGGGCCAAGGG + Intronic
907389986 1:54151846-54151868 TGGAGGATGTGGAAGGCCGACGG + Intronic
913063913 1:115232255-115232277 ATGGGGATGGGGAGGGCAGAGGG + Intergenic
920096903 1:203492276-203492298 CTGTGGGGGTGGAGGGCCTCTGG + Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922724904 1:227918226-227918248 CTGTGGAAGAGGAGGGCCCTCGG - Intergenic
923013029 1:230104178-230104200 CTGGGGTGGTGGGGGGCCGAGGG + Intronic
923098199 1:230792329-230792351 CTGCAGAGGGGGAGGGCCGATGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1064353221 10:14595913-14595935 CTGTGGTTGTGGAGGGCCACGGG - Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067658336 10:48214514-48214536 CTGTGCATGTAGAGGGGCAAGGG + Intronic
1070453219 10:76582580-76582602 GTGTGCATGGGGAGGGCCCATGG - Intergenic
1070721203 10:78758389-78758411 CTGTGGATGGAGAGAGCCGCTGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071129353 10:82373388-82373410 ATGTGGATGTGGAGAGACAAAGG + Intronic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1071514956 10:86291199-86291221 CTGTGGATCTGGAGGCCCTCTGG - Intronic
1074526866 10:114270253-114270275 CTTTGGAAGTGGAGGGCCCTGGG + Intronic
1075353433 10:121747146-121747168 CTGTGGATGTGAAGGCCCTCTGG - Intronic
1075736470 10:124667538-124667560 CTGTGGATGTGGAGGCTCAGAGG - Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1077331753 11:1987054-1987076 CTGTGGATGTGCATGGCCTCAGG - Intergenic
1077478126 11:2800516-2800538 CTGAGGCTGTGTAGGGCCCAGGG + Intronic
1078652983 11:13213174-13213196 CTATGGCTGTAGAGGGCAGAGGG + Intergenic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1084004319 11:66315111-66315133 ATGGGGATGTGTAGGGCTGATGG + Exonic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084331443 11:68432869-68432891 CTGAGGACGTGGAGCCCCGAGGG + Intronic
1085041668 11:73330564-73330586 CTGTGGCTGTGGAGGGGCAGGGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085739937 11:79069954-79069976 TTGTGGATGTGGAGGAGCGCGGG - Exonic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089843113 11:121435984-121436006 CTGAGGCTGTGGGGGGCCCAGGG - Intergenic
1202814734 11_KI270721v1_random:42230-42252 CTGTGGATGTGCATGGCCTCAGG - Intergenic
1091753281 12:3035911-3035933 CTGTGGCTGTGACTGGCCGAAGG - Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1096332174 12:50723259-50723281 CTGAGCATGTGGAGGTCTGACGG - Exonic
1096438889 12:51621618-51621640 CTCTGGATGTGGAGAGACTAGGG + Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1099793721 12:87369054-87369076 GTGTGTATGTGGAGGGCGGGGGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103202251 12:119097252-119097274 GTGGGGCTGTGGAGGGCTGAGGG + Intronic
1103619038 12:122174694-122174716 CTGTGAATGTGGCGGGTCGAAGG + Intronic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104759229 12:131287114-131287136 CTGTGGATGATGGGGGCCCAGGG - Intergenic
1104821382 12:131679382-131679404 CTGTGGATGATGGGGGCCCAGGG + Intergenic
1105423535 13:20273536-20273558 CTGTGGGTGTGGAGGTCCTGTGG + Intergenic
1105547020 13:21358189-21358211 CTGTGCATGTGTAGGGGGGAAGG + Intergenic
1105578909 13:21675569-21675591 CGGAGGAGGAGGAGGGCCGAAGG - Intronic
1105847316 13:24304564-24304586 CTCTGGATGTGGGGGGCTGCAGG - Exonic
1106756193 13:32825351-32825373 CTGTAGATCTGGAAGGCTGATGG - Intergenic
1107423131 13:40268265-40268287 CTCCTGATGTGGAGGGCCCATGG - Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1111291541 13:86177508-86177530 CTGTGGATATGGAGGGCCACTGG + Intergenic
1112227842 13:97558057-97558079 CTGTTGATGTGCTGGGCCTAAGG - Intergenic
1115173999 14:30541363-30541385 CTGTAGAAGAGGAGGGCCTAGGG + Intergenic
1115343612 14:32318613-32318635 CAGTGGTTGTGGATGGCCGACGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118705636 14:68477876-68477898 CTCTAGATGTGTAGGGCTGAGGG + Intronic
1121331006 14:93049816-93049838 ATGTGGATGTGGAGGGACAGAGG + Intronic
1121426262 14:93854347-93854369 CTGTCACTGTGGAGGGCCAAAGG - Intergenic
1122268683 14:100558620-100558642 CTGTGGATTTGTAGGGGCGATGG - Intronic
1122874333 14:104656602-104656624 CTGAGGACGTGGAGGGCGGTGGG + Intergenic
1122922747 14:104886686-104886708 CAGGGGATGGGGAGGGCCTAGGG + Exonic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG + Intergenic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1132873183 16:2124550-2124572 CTGTGGATTGGGAGGGCCCCGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136316186 16:29455758-29455780 CTGGGGCGGTGGAGGCCCGAAGG - Exonic
1136430763 16:30195100-30195122 CTGGGGCGGTGGAGGCCCGAAGG - Exonic
1136592034 16:31223351-31223373 CTGTGGCTGGGGAGGCCCAAGGG + Intronic
1137628913 16:49928339-49928361 GTGGGGATGTGGAGGGCCCAAGG - Intergenic
1137716548 16:50601748-50601770 CTGTGGCTGTGGTGGGCTCAGGG + Intronic
1138300980 16:55929495-55929517 CTGTGGATGTGGAGGCGCAGAGG - Intronic
1139960933 16:70716873-70716895 CTGTGGATCTGGAGGGTCACTGG + Intronic
1140039254 16:71394821-71394843 CGGTGGATGTGGAGGGGCACGGG + Intergenic
1140046653 16:71443936-71443958 CTGTGGATGTGGGGGTCTGTGGG + Intergenic
1140046687 16:71444209-71444231 CTGTGGATGTGGGGGTCCGCAGG + Intergenic
1141266991 16:82506674-82506696 CTGGAGATGGGGAGGGGCGAAGG - Intergenic
1141620008 16:85232343-85232365 CTGGGAAGGTGGAGGTCCGAGGG - Intergenic
1141708375 16:85682741-85682763 CTGTAGAGGGGGAGGGCTGAGGG - Intronic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1142419704 16:89962858-89962880 CTGTGGCTGTGCAGGGCTGGTGG + Intronic
1143427500 17:6851864-6851886 GTGTGAATGTGCAGGGCTGAGGG + Intergenic
1143733169 17:8892775-8892797 CTGGGAATGAGGAGGGCCGGGGG + Intronic
1144341173 17:14311449-14311471 CTGTGCATGTGTAGGACTGATGG - Intronic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1145050710 17:19658235-19658257 TTGTGTATGTAGAGGGCCTAGGG + Intronic
1148000838 17:44386042-44386064 CTGTGCCCCTGGAGGGCCGAGGG - Exonic
1148105069 17:45114626-45114648 CAGTGGAGCTGGAGGGCCGTGGG - Intronic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1149265929 17:54927666-54927688 CTGTGGATGTGGGGAGCCAGGGG - Intronic
1149667622 17:58376789-58376811 GTGTGGCTGTGGAGGGCTCATGG + Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152562718 17:81086635-81086657 CTGTGGACGAGGGGGGCCGAGGG - Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152800636 17:82329206-82329228 CTGTGGCTGTGCAGGGCCCAGGG - Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152862809 17:82705577-82705599 CCGTGGATGCGTGGGGCCGAGGG + Intergenic
1152988215 18:338537-338559 CTGTGGATGTGGAGACCCACTGG - Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156569365 18:38235527-38235549 ATGTGGATGGAGAGGGCTGATGG + Intergenic
1157528946 18:48406110-48406132 CTGTGCCTGTGTAGGGCTGAAGG - Intronic
1157755040 18:50210216-50210238 CAGGGGATGTGGAGTGCCAAGGG - Intergenic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1166832148 19:45645336-45645358 CGGTGGCTGTGGTGGGGCGATGG - Exonic
1166960066 19:46491929-46491951 CTGTGGGTGGGGAGGGCCCCAGG - Exonic
1168151068 19:54449130-54449152 CATTGGCTGTGCAGGGCCGAGGG + Exonic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
934527709 2:95061939-95061961 GTGTGGATGTGGAGGCCCCACGG - Intergenic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
938540366 2:132280087-132280109 CCGTGGAGGTGGCGGGCCGCGGG - Intergenic
944486752 2:200214770-200214792 CTTTGGATGTGGAGCGCTGGAGG - Intergenic
944709605 2:202323965-202323987 CTGTGAATTTGGAGGGGCGCTGG + Intergenic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946646862 2:221846712-221846734 CATTGGATGTGGAGGGCCCTTGG - Intergenic
946861119 2:224001244-224001266 GGGTGGCTGTGGAGGGCCCAGGG - Intronic
947871005 2:233438006-233438028 TTGTGAATGTGGAGGTCAGATGG + Intronic
948786886 2:240357347-240357369 CTGTGCAAACGGAGGGCCGAGGG - Intergenic
1169347188 20:4838113-4838135 CAGTGGATGTGGAGAGACAAGGG + Intergenic
1170093974 20:12624423-12624445 CTGTGTATGTGTGGGGGCGAGGG + Intergenic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1176026004 20:62985975-62985997 CTGTGGTTGTGGGGCCCCGAGGG - Intergenic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176385786 21:6138038-6138060 CTGTGGATGCGTAGGCCAGAGGG - Intergenic
1177348175 21:19900317-19900339 CTGTGCATGTGTAGGGTGGAGGG - Intergenic
1179542639 21:42093592-42093614 CTGTGGATGTGGCGGGCTCCAGG + Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179737687 21:43400214-43400236 CTGTGGATGCGTAGGCCAGAGGG + Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180825486 22:18858161-18858183 ATGAGGATGTGGTGGGCAGAGGG - Intronic
1181187246 22:21116386-21116408 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181211952 22:21294107-21294129 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181397545 22:22632779-22632801 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181651861 22:24263279-24263301 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181705516 22:24647460-24647482 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1183467870 22:37988927-37988949 CTGGGAAGGTGGAGGGCCGACGG + Intronic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
1184617646 22:45648780-45648802 CTGCGGATGAGCAGGGCGGAAGG - Intergenic
1184686904 22:46100360-46100382 CTGGGGCTGTGGAGGGCCTCTGG + Intronic
1184860214 22:47169248-47169270 CTGTTGAAGTTGAGGGCCGGTGG - Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
1203215002 22_KI270731v1_random:1325-1347 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1203275634 22_KI270734v1_random:84064-84086 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
950483857 3:13261284-13261306 CGGTCGATGTGGAGGGACAAAGG + Intergenic
952377697 3:32781067-32781089 CTGGGGTGGGGGAGGGCCGAGGG - Intergenic
953666412 3:44929250-44929272 CTGGGGATGGGGAGGACCCAGGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
960271324 3:115677530-115677552 CTGTGGATGTGTTGGGGTGAGGG - Intronic
960928755 3:122822954-122822976 GTGGGGAGGTGGAGGGCGGATGG - Intronic
961109159 3:124268942-124268964 CTGTGGATGTGGAGGGCTCTCGG + Exonic
961557615 3:127707296-127707318 CTGAGTATGTGGATGGCTGAGGG + Intronic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
963130056 3:141849619-141849641 AAGTGGATGTTGAGGGCTGACGG + Intergenic
964958347 3:162391073-162391095 TTGAAGATGTGGAGGGCTGAAGG + Intergenic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
969311038 4:6353403-6353425 CTGTCGGTGTGGAGGGCTGTCGG - Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
975351255 4:73349899-73349921 GAGTGGATGTTGAGGGCAGAGGG + Intergenic
978391172 4:108226855-108226877 TCATGGATGTGGAGGGCTGACGG + Intergenic
980493087 4:133555115-133555137 CTGTGGATGTTGAGAGCCGGAGG - Intergenic
982073132 4:151713319-151713341 CTGTGGACTTGGGGGGCCGAAGG - Intronic
983919887 4:173334113-173334135 CTGGGTCTGTGGAGGGCCGGCGG - Intronic
984811279 4:183798028-183798050 CAGCGGATGTGGAAGCCCGAGGG - Intergenic
984886430 4:184454148-184454170 CTGTGGATGTGGAGTGTGGGAGG - Intronic
985889432 5:2704317-2704339 CTGAGGATGGGGAGCGCTGATGG + Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
991638916 5:68734093-68734115 CCACGGATGTGAAGGGCCGACGG - Intergenic
999065222 5:148678496-148678518 CTGAGAATGAGGAGGGCCCAAGG - Intergenic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1003026959 6:2563688-2563710 CTGTGGATCTGGAGCTCCCATGG - Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006516154 6:34546813-34546835 CTGGGGATGTGGGGGACAGAGGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006743118 6:36323299-36323321 TGCTGGAGGTGGAGGGCCGATGG + Exonic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012562186 6:100596893-100596915 TTGGGGATGTGGAGGGCCAGTGG - Intronic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1014701035 6:124688387-124688409 CTGTGCATGTGGAGGGGCAGGGG - Intronic
1015447335 6:133321900-133321922 CTCTGGACGTAGAGGCCCGAGGG + Intronic
1015499286 6:133915285-133915307 TTGTGGATATGGAGGGCTGGTGG - Intergenic
1016936977 6:149454896-149454918 CCGTGGAGGTGGAGGGCCAGAGG - Intronic
1017510783 6:155112833-155112855 CTGAAGCTCTGGAGGGCCGAAGG - Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1018852914 6:167653974-167653996 CTCGGGATGTGCAGGGCCCATGG + Intergenic
1019478201 7:1254311-1254333 CGGTGGGTGGGGAGGGCCGCTGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022522882 7:31019341-31019363 CTGTGGCTGTGGTGGGCTGTGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023618784 7:42048582-42048604 GTAGGGATGTGGAGGGCTGAAGG + Exonic
1023806027 7:43873494-43873516 GTGTGTATGTGGCGGGGCGAGGG + Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1033482854 7:141759429-141759451 CTGTGGATACGGAGGGCCAGTGG - Intronic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1048853750 8:138669157-138669179 CTGTGGCTGCGGAGTGGCGAAGG + Intronic
1049500271 8:142959472-142959494 GTGTGGAGGTGGAGGCGCGAGGG + Intergenic
1050437756 9:5628582-5628604 CTGTGGCTGTGGTGGGCGGTAGG - Intergenic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1055712041 9:79073916-79073938 CTGTGGATGTGAAGGGACAGGGG + Intergenic
1058690296 9:107514675-107514697 CTGCGGATGTGGAGGGCCAGAGG + Intergenic
1059399711 9:114061255-114061277 CTTTGGATGTGGAGGACCTCGGG - Intronic
1185506889 X:638448-638470 CAGTGGAGGTGGAGGTCTGAAGG + Intronic
1186521732 X:10212470-10212492 CTGGGGATGAAGAGGCCCGACGG - Exonic
1187431605 X:19229909-19229931 CTGTCGATGGGGAGGGGCGCTGG - Intergenic
1192174603 X:68877955-68877977 CTGGGGCTGGGTAGGGCCGAAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198410578 X:136363029-136363051 GGGTGGATGATGAGGGCCGATGG + Intronic
1199474671 X:148232095-148232117 CTGTGGATGATGAGGGCCTGTGG + Intergenic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1200761312 Y:7041804-7041826 CTGTGGAAGTCTAGGGGCGATGG - Intronic