ID: 1154308951

View in Genome Browser
Species Human (GRCh38)
Location 18:13253030-13253052
Sequence CAGGGTGCCCAGAGTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 539}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154308951 Original CRISPR CAGGGTGCCCAGAGTGAAGC AGG (reversed) Intronic
900374458 1:2347113-2347135 CATGGGGCCAAGAGTGCAGCTGG - Intronic
900400782 1:2472070-2472092 CAGGGATCCCAGAGTCAGGCTGG - Intronic
900640433 1:3685717-3685739 CAGGGGTCCCAGAGTGGGGCTGG + Intronic
900670872 1:3853998-3854020 TAGGTTGCCCAGAGTGCAGGTGG - Intronic
901065223 1:6491071-6491093 GAGGGGGCCCAGAGAAAAGCGGG - Intronic
901666957 1:10831548-10831570 CAGGCTGCCCGGAGTCCAGCTGG + Intergenic
901686869 1:10948049-10948071 CGGGATGCCCAGGGTGAGGCTGG - Exonic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902292915 1:15446861-15446883 CAGGGAGTCCTGCGTGAAGCCGG + Intronic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
902923011 1:19678649-19678671 CAGGATGCCCAGCGTCAGGCTGG - Exonic
902930112 1:19725176-19725198 CCTAGGGCCCAGAGTGAAGCAGG + Intronic
902934920 1:19758198-19758220 CAGGGTCCCCAGAGTGAAACAGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903355218 1:22742255-22742277 AAGGATGCCCAGAGTGAGACAGG + Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
903929506 1:26854212-26854234 CAGGGTCCTCAGGGTGAAGCAGG + Exonic
904008088 1:27374221-27374243 CCGGGTGCCCAGCCTGGAGCTGG + Intronic
904206966 1:28861770-28861792 CAGGCTCCCTAGAGGGAAGCAGG - Intronic
905429128 1:37908889-37908911 AAGGTTGCCCATAGTGAAGGAGG - Intronic
906101955 1:43269748-43269770 CAAGTTGCCCAGACTGAGGCTGG + Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907503712 1:54902333-54902355 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
907521099 1:55023843-55023865 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
907528453 1:55069419-55069441 CACAGTGCCCAACGTGAAGCGGG - Intronic
908852259 1:68387509-68387531 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
909000829 1:70215739-70215761 CAGGGTTCCCAGTGGGTAGCGGG + Intronic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909014564 1:70368592-70368614 AAGGTTGCCCATAGTGAAGGAGG - Intronic
909035320 1:70589554-70589576 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
909729237 1:78873142-78873164 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
909776845 1:79493028-79493050 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
910283689 1:85529887-85529909 CACCTTGCCCAGTGTGAAGCAGG + Intronic
911381286 1:97118255-97118277 CAGGGTGCCCAGAGTCTGGGTGG - Intronic
911793341 1:102046450-102046472 CATGTTGCCCAGGGTGAAGACGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912413143 1:109491411-109491433 AATGGGGCCAAGAGTGAAGCGGG + Exonic
913374258 1:118133285-118133307 GAGGGGGCCCAGAGTGCAGATGG + Intronic
914206326 1:145533103-145533125 CACCTTGCCCAGTGTGAAGCAGG - Intergenic
914267788 1:146052678-146052700 AAGGGTGCCCAGGGTCCAGCTGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915708594 1:157871387-157871409 CAGGGTGCCCTGGCTGAACCCGG - Intronic
919476250 1:198036035-198036057 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
920007678 1:202845248-202845270 CAGGCTGCCCAGAGTGCCCCAGG + Intergenic
920907862 1:210188547-210188569 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
921519984 1:216146789-216146811 AAGGTTGCCCATAGTGAAGGAGG - Intronic
921733118 1:218598257-218598279 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
922046239 1:221948803-221948825 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
922048271 1:221967213-221967235 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
922200021 1:223393620-223393642 CCGGGTGCGGAGAGCGAAGCTGG + Exonic
922467266 1:225852932-225852954 CTGGGTGCACTGAGTGAAGCAGG - Intronic
922598822 1:226834478-226834500 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
922934676 1:229413640-229413662 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
923292657 1:232561697-232561719 CAGGCTGTCCAGAGTGACTCTGG + Intergenic
924536161 1:244937487-244937509 TAGGGTGACCAGTGGGAAGCTGG - Intergenic
1063106559 10:2997487-2997509 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1063122513 10:3114800-3114822 CAGGCTGCCCACAAAGAAGCCGG - Intronic
1064213916 10:13383690-13383712 CAGGGTGCTCCGAGTGAAGAGGG - Intergenic
1064222485 10:13454033-13454055 CAAGGAGCCCAGAGAGCAGCAGG + Intronic
1064887138 10:20123631-20123653 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1065226845 10:23552272-23552294 CAGTGTGGCCAGAATAAAGCAGG + Intergenic
1066103516 10:32137919-32137941 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1066337538 10:34494273-34494295 GAGAGTGCCTAGAGTTAAGCAGG + Intronic
1066437510 10:35407733-35407755 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1069997822 10:72353998-72354020 CAGGGAGGGAAGAGTGAAGCTGG - Intronic
1070144409 10:73763413-73763435 CAGAGTGCCAAGAGTGAAAAAGG - Intronic
1070565966 10:77604094-77604116 CAGGTTGCCCTGTGTGCAGCAGG + Intronic
1070724749 10:78780322-78780344 CAGGGGGCACAGAATGGAGCTGG + Intergenic
1070789278 10:79180042-79180064 CAGGGTGCCGAGGGTGGAGACGG + Intronic
1071133595 10:82426197-82426219 CAGGGGTCTCAGAGTGAAGATGG - Intronic
1071187085 10:83058374-83058396 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1072884380 10:99260822-99260844 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1073013732 10:100381871-100381893 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1073394426 10:103206418-103206440 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1073477695 10:103765165-103765187 CAGGGTTTCCAGGGTGAACCCGG + Intronic
1073683382 10:105728563-105728585 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1073709638 10:106022089-106022111 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1074018873 10:109563564-109563586 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1075747377 10:124737122-124737144 CTGGGTGTCCAGTGTGGAGCCGG - Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077679270 11:4224089-4224111 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1077688703 11:4320731-4320753 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1078739189 11:14050778-14050800 CAGTGTGCCCAGGGTAAACCGGG + Intronic
1079189196 11:18263906-18263928 AAGGTTGCCCAGAGTGTAGCAGG - Intergenic
1080591808 11:33730779-33730801 CAGGGTGCCACAAGTGATGCTGG + Intronic
1080644896 11:34181401-34181423 CAGGGACCCCAGAGTGAGTCAGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083309471 11:61777037-61777059 CAGGGTCTCCACAGTAAAGCAGG + Intronic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1084273549 11:68040941-68040963 GAGGGAGGCCAGAGTGAAGGTGG + Intronic
1085191209 11:74624894-74624916 TAACTTGCCCAGAGTGAAGCGGG + Intronic
1085532402 11:77199669-77199691 GATGGTGGCCAGCGTGAAGCTGG - Exonic
1086550052 11:88044394-88044416 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1086657903 11:89382208-89382230 AAGGTTGCCCATAGTGAAGAAGG - Intronic
1087168059 11:95024014-95024036 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1088321173 11:108555961-108555983 AAGGGGAGCCAGAGTGAAGCAGG - Intronic
1088902680 11:114130060-114130082 CAGGATGCCCAGGGAGGAGCAGG + Intronic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1092928312 12:13291965-13291987 CAGAGTACCCAGGGTGAAGAAGG - Intergenic
1093000293 12:13988609-13988631 CAGGGTGCCAGGAGTGAGGGAGG - Intergenic
1093071307 12:14709339-14709361 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1093268158 12:17026153-17026175 AAGGTTGCCCATAGTGAAGGGGG + Intergenic
1093322133 12:17724756-17724778 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1094316206 12:29139506-29139528 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1095659759 12:44717862-44717884 CAAGGAGACCAGAGTGATGCAGG + Intronic
1096575270 12:52548863-52548885 CTGGGTTCCCTGAGTGAAGAAGG + Intronic
1097106816 12:56630526-56630548 CAGTTTGCCCTGTGTGAAGCAGG - Intronic
1097160607 12:57044083-57044105 GTGGGTGCCCAGGGTGAGGCAGG - Intronic
1097510263 12:60529953-60529975 CAGGATGCCCAGTGTGCACCTGG + Intergenic
1097542347 12:60956465-60956487 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1097694036 12:62759976-62759998 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1098595792 12:72272434-72272456 CCCGGTGTCCAGAGTGAGGCGGG + Intronic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1098919755 12:76292675-76292697 AAGCGTGCCCACAGTGAAGAAGG - Intergenic
1099292240 12:80787547-80787569 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1099810629 12:87578058-87578080 CAGGGTGCCAAGGATGGAGCTGG + Intergenic
1100940150 12:99716417-99716439 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102356504 12:112241294-112241316 CAGGGTGCCCAGAAAGAAATAGG - Intronic
1102510920 12:113414858-113414880 GAGGGTGCCCCGAGTGCAGCAGG - Intronic
1102604272 12:114056700-114056722 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1102886980 12:116529725-116529747 CACAGTGCCCAGCCTGAAGCAGG + Intergenic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1103176004 12:118863734-118863756 CAGGGCGCCCAGAGAGGACCAGG + Intergenic
1103705625 12:122870283-122870305 CAGGGTCTGCAGTGTGAAGCAGG - Intronic
1105049367 12:133035032-133035054 CAGGGTGCACACTGTGAAGGGGG - Intergenic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1106579190 13:31003139-31003161 CGGGGTGAACTGAGTGAAGCAGG - Intergenic
1106848889 13:33767247-33767269 TCGGGTTCCCAGAGTAAAGCTGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1108551351 13:51548728-51548750 CAGGGAGCCCAGCTTCAAGCAGG - Intergenic
1108804018 13:54132168-54132190 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1110650665 13:77938162-77938184 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1110765324 13:79275376-79275398 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1110845183 13:80184800-80184822 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1111126185 13:83912736-83912758 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1111695794 13:91622092-91622114 CAGGGTGGCTAGAATAAAGCAGG - Intronic
1112524702 13:100133809-100133831 CAGCGTGGCTAGAATGAAGCAGG + Intronic
1112562383 13:100526053-100526075 CAGGGTCCCCTGTGTGGAGCTGG + Intronic
1112889470 13:104212532-104212554 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1113424210 13:110194533-110194555 CCGAGAGCCCAGAGTGAAGCTGG + Intronic
1113574720 13:111387111-111387133 CAGGGTGTCCACAGTGATGGTGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1117660912 14:58003663-58003685 CGGGGTGCCCTGAGAGAGGCTGG + Exonic
1118746885 14:68780757-68780779 CAGGATGCACAGAGAGAAGCAGG + Intergenic
1119317052 14:73704734-73704756 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1119560479 14:75585500-75585522 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1119757807 14:77131074-77131096 CAGGGTCCCCAGGGAGGAGCAGG + Intronic
1120251543 14:82065561-82065583 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1121045708 14:90786096-90786118 AAGGGTGCCCAGGGTTGAGCCGG - Intronic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122179134 14:99943061-99943083 CAGAGTCCCCAGAGTGAGACAGG - Intergenic
1122507478 14:102240851-102240873 AAGGTTGCCCATAGTGAAGCAGG - Intronic
1122616565 14:103022038-103022060 CAAGGTGCCCAGTGTACAGCTGG + Intronic
1122761664 14:104033301-104033323 CAGGAGCCCCAGTGTGAAGCCGG + Intronic
1122800279 14:104225870-104225892 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1122800303 14:104225975-104225997 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1122843764 14:104479444-104479466 CTCGGTGCCCAGCGTGAGGCTGG + Intronic
1123112424 14:105879634-105879656 CAGGGTGCCCAGGGGCAGGCAGG - Intergenic
1125327863 15:38555016-38555038 CAAGGTGCCCAGAGGGCAACAGG - Intronic
1125550458 15:40540870-40540892 CAGAGAGCCCAGTGAGAAGCTGG + Intronic
1125629016 15:41132365-41132387 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1128300568 15:66564228-66564250 CAGGGTGCCCCTAGTAAACCTGG + Intronic
1128659545 15:69488184-69488206 CAGGGAGCTCAGAGAGTAGCAGG + Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129331672 15:74831070-74831092 CAGAGTGCCAAGGATGAAGCTGG + Exonic
1129766892 15:78175416-78175438 CAAGGAGCCCACAGTGCAGCGGG + Intronic
1131164705 15:90134019-90134041 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1131447584 15:92512747-92512769 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132262862 15:100441515-100441537 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1132321439 15:100928444-100928466 CAGTGTTCCCTGAGTGAGGCTGG - Intronic
1132612329 16:823524-823546 CACCGTGCGGAGAGTGAAGCTGG + Intergenic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133766864 16:8844273-8844295 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1133869754 16:9675957-9675979 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1134690112 16:16185462-16185484 CAGCCTTCCCAGAGTGAAGGGGG + Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1135221768 16:20620774-20620796 CAGGGTGCCCTGAGAGGACCAGG - Intronic
1135424490 16:22325580-22325602 CAGCGTGCCGAGAGTCATGCGGG - Intronic
1136096683 16:27962069-27962091 TAGGCTGCCAAGAGTGAAACAGG - Intronic
1136560480 16:31036193-31036215 CAGGGACCCCAGATTGAAGATGG + Intronic
1136626645 16:31465917-31465939 CAGGGCTCCCAGAGAGCAGCAGG - Exonic
1136684833 16:31988073-31988095 CAGGGTGCTCAGGCTGGAGCAGG + Intergenic
1136785447 16:32931608-32931630 CAGGGTGCTCAGGCTGGAGCAGG + Intergenic
1136884325 16:33922196-33922218 CAGGGTGCTCAGGCTGGAGCAGG - Intergenic
1137363287 16:47839740-47839762 AAGGTTGCCCATAGTGAAGAAGG - Intergenic
1137563285 16:49516586-49516608 AATGCTGCCAAGAGTGAAGCAGG - Intronic
1137797193 16:51231889-51231911 CAAGTTTCCCAGCGTGAAGCTGG - Intergenic
1138196810 16:55058129-55058151 CAGGGCACCCAGAGTGGAGCAGG + Intergenic
1138514647 16:57529281-57529303 CCGGTGGCCCAGAGGGAAGCGGG - Exonic
1138655780 16:58490475-58490497 CAGGGTGCCCAGAGGGCATGAGG - Intronic
1139039378 16:62983622-62983644 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1139943859 16:70625234-70625256 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1139948754 16:70659165-70659187 CAGGGTGTCCAGCTTCAAGCTGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141514896 16:84537283-84537305 CAGGGCGCCCATATGGAAGCAGG + Intronic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1141560810 16:84866635-84866657 CAGGCTGCCCAGAGGTTAGCAGG - Intronic
1141879352 16:86847562-86847584 CAGGGCTCCTAGAGAGAAGCAGG - Intergenic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143651396 17:8266048-8266070 CAGGGTGCCAGGCGTGCAGCAGG + Intronic
1143768736 17:9154296-9154318 CATGGTGCCCAGAATGCACCAGG + Intronic
1143785106 17:9249964-9249986 CAGGATGCCCAGAGTACTGCGGG + Intergenic
1147986652 17:44310850-44310872 GAGGGTGCGCATAGTGAAGCTGG + Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1148694344 17:49550050-49550072 CAGGGACTCCAGAGTGAAGGGGG - Intergenic
1149417895 17:56479466-56479488 CAGTATGCCCAGATTGAAGTAGG + Intronic
1150233563 17:63573868-63573890 CAGGGAGCCCAGAGGGGAACAGG - Intronic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1150646089 17:66978392-66978414 GAGGGGACCCAGAGTGAAGATGG + Intronic
1152143853 17:78555687-78555709 CAGGGTGCCCAGATTAAACATGG + Intronic
1152453745 17:80400768-80400790 AAGGTTGCCCACAGTGAAGGAGG - Intergenic
1152455457 17:80413548-80413570 CAGGGTGCGCAGGGTGCAGTGGG + Intergenic
1153550757 18:6259062-6259084 CAGAGTGCCCGGGGGGAAGCAGG + Intronic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154979417 18:21490201-21490223 CAGGGTGCCCTCGGTGCAGCTGG + Exonic
1155239443 18:23851552-23851574 CTGGGTGCTCAGAGTGTATCAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155941396 18:31805018-31805040 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1155961801 18:32001494-32001516 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1156252080 18:35360793-35360815 AAGGTTGCCCATAGTGAAGAAGG + Intergenic
1156356681 18:36348366-36348388 CAGGGGACCCATAGTCAAGCTGG + Intronic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1157906553 18:51574539-51574561 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1158576850 18:58645454-58645476 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1159582980 18:70253666-70253688 CAGGGTGCTGAGGGTGAAGGGGG - Intergenic
1159929068 18:74293695-74293717 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1160141272 18:76325349-76325371 CATGGAGCCCAGAGTGCAGGAGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160556032 18:79725843-79725865 CACGGAGCCCAGAAGGAAGCCGG - Intronic
1160594303 18:79963725-79963747 CACGGTGCCCAGCGAGGAGCAGG - Intergenic
1160607673 18:80064657-80064679 CACGGTGCCCAGCAAGAAGCAGG - Intronic
1160662325 19:306841-306863 CGGGGTGCCCTGAGGGGAGCTGG + Intronic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1161711061 19:5848295-5848317 AAGGTTGCCCATAGTGAAGTAGG - Intronic
1162028231 19:7906068-7906090 CAGGGAGTCCAAAGTGGAGCTGG - Intronic
1162095960 19:8310052-8310074 CAGGGTGACCATGGTCAAGCAGG + Intronic
1162402511 19:10454491-10454513 CAGGGAGCCAATAGGGAAGCAGG - Intronic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1163263120 19:16203352-16203374 CGGAGTCCCCAGAGCGAAGCAGG + Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163633303 19:18427670-18427692 CAGGGTGCCCAGAGAACATCTGG - Intronic
1164202646 19:23031287-23031309 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1164668408 19:30058641-30058663 GTGGGTGCCCTGGGTGAAGCAGG + Intergenic
1164826668 19:31289353-31289375 AAGGCTGCCCAGAGTGAGGAGGG - Intronic
1165472804 19:36013309-36013331 CAGGGTGCAGAGGGTGAAGGAGG - Intronic
1165957130 19:39507935-39507957 CAGCGCGCCCAGTGTGTAGCGGG - Exonic
1166905948 19:46108548-46108570 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1167099259 19:47393921-47393943 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1167291794 19:48628875-48628897 CACCGTGCCCAGTGTGAAGCGGG - Exonic
1167340657 19:48913872-48913894 CAGGGTTCCCAGAGTGGACCAGG - Intronic
1167369048 19:49070091-49070113 GGGGGTGCCCAGAGTGGAGGTGG + Exonic
1167528646 19:50001204-50001226 CAGGTTCCCCAGAGGAAAGCAGG - Intronic
1168228129 19:55011230-55011252 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1168652219 19:58098399-58098421 CATGGTGCCCAAAATGACGCAGG - Intronic
1202709454 1_KI270714v1_random:9549-9571 AAGGGTGCCCAGGGTCCAGCTGG + Intergenic
925641600 2:5990586-5990608 CCGGGTGGTCAGAGTGAGGCTGG - Intergenic
926313898 2:11695695-11695717 GCGGGTGGCCAGAGGGAAGCTGG + Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926407630 2:12571017-12571039 AAGGTTGCCCATAGTGAAGGCGG - Intergenic
926464229 2:13168440-13168462 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
926647218 2:15302822-15302844 CAGTGTGCCTAGAATAAAGCAGG + Intronic
926672815 2:15591689-15591711 CATGGTGCCCAGAACGAAGGCGG + Exonic
927727351 2:25436445-25436467 AAGAGTGTACAGAGTGAAGCAGG - Intronic
928778149 2:34790942-34790964 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
928928411 2:36600285-36600307 AAGGTTGCCCATAGTGAAGGAGG - Intronic
929393446 2:41496794-41496816 CAGGGAGCCCAGGGTGATTCTGG + Intergenic
929684684 2:44023533-44023555 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
930107102 2:47648929-47648951 TCAGGTGCCCAGATTGAAGCTGG - Intergenic
932614128 2:73221213-73221235 GATGGTGGCCACAGTGAAGCAGG + Exonic
934581265 2:95441807-95441829 TAGGGTGCCCTTAGGGAAGCTGG - Intergenic
934598185 2:95634907-95634929 TAGGGTGCCCTTAGGGAAGCTGG + Intergenic
934711315 2:96516157-96516179 CAGGGGGCCCAGTGAGAAACTGG + Intergenic
934941358 2:98505006-98505028 CAGAGAGCCTAGAGTGAATCTGG - Intronic
935229356 2:101082406-101082428 CAGGGTGCCCAGCCTGCAGGAGG - Intronic
935293371 2:101628062-101628084 CAGGGTGCCCGGTGTGCAGCAGG - Intergenic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
937891833 2:126945080-126945102 CAGGGTGCCTAAAGTGTGGCAGG - Intergenic
937909083 2:127066671-127066693 CAGGGTGCCCATGGGGAACCAGG - Intronic
938181624 2:129189844-129189866 TAGGGTGGCCTGAGTGTAGCAGG + Intergenic
939460881 2:142494334-142494356 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
940216664 2:151310047-151310069 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
940293261 2:152098426-152098448 CACGGGGGCCAGAGAGAAGCCGG + Intronic
941244078 2:163075053-163075075 CAGGGAGTTCAGAGAGAAGCTGG - Intergenic
942311503 2:174661154-174661176 CAGGGAGGCCAGCGTGCAGCAGG + Intronic
943449976 2:188034448-188034470 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
943585566 2:189735224-189735246 CAGGGTCCAGAGAGTGAAGCAGG - Intronic
944250877 2:197579331-197579353 AAGGTTGCCCATAGTGAAGGAGG - Intronic
944387300 2:199180619-199180641 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
945361500 2:208900468-208900490 AAGGTTGCCCATAGTGAAGGTGG - Intergenic
945578301 2:211559720-211559742 TAGGGTGCACAGAGAGAACCAGG + Intronic
946215175 2:218178475-218178497 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946533804 2:220605399-220605421 CAGTGTGCCCAAAATAAAGCAGG - Intergenic
946615561 2:221505776-221505798 CAGGGTGCTGAAAGTGAAGGAGG + Intronic
946871921 2:224092340-224092362 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
946893133 2:224297932-224297954 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947921049 2:233874569-233874591 CAGCGTGGCCAGAATAAAGCAGG + Intergenic
947954738 2:234178900-234178922 CCTGGCGCCCAGAGTGCAGCAGG - Intergenic
947994073 2:234512372-234512394 TAGGATGGCCAGTGTGAAGCAGG + Intergenic
948465325 2:238149288-238149310 CAGAGGGCCCACAGTGAAGGGGG + Intronic
948465338 2:238149332-238149354 CAGAGGGCCCACAGTGAAGAGGG + Intronic
1168739197 20:173753-173775 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1170945435 20:20887432-20887454 CACGGGGCCCAGAGACAAGCTGG - Intergenic
1171448106 20:25218751-25218773 CTGGGTGCCCAGCATGCAGCGGG - Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172110453 20:32541635-32541657 GTGGGGGCCCAGAGAGAAGCTGG - Intronic
1172132051 20:32662240-32662262 CAGTGTGCCCAGAGTCAGCCAGG - Intergenic
1172605126 20:36208856-36208878 CATGGAGCCCAGGGTGGAGCTGG + Intronic
1172870513 20:38132655-38132677 CAGGGTTCCCAGCGAGGAGCTGG + Intronic
1175367919 20:58467987-58468009 CCAGGTGCCCAGAGTCCAGCGGG - Intronic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175626012 20:60488863-60488885 CAGGGTGGCTAGAATAAAGCAGG - Intergenic
1175978431 20:62725264-62725286 CAGGGAGGCCAGAATGATGCTGG - Intronic
1177119415 21:17122711-17122733 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1177998865 21:28135403-28135425 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
1178001049 21:28162408-28162430 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1179650521 21:42805520-42805542 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1179672917 21:42962404-42962426 CAGGGTCCCCAGTGAGAACCTGG + Intergenic
1180844783 22:18975136-18975158 CAGGCTGCTCTGAGTGAGGCTGG - Intergenic
1181056684 22:20263576-20263598 CAGGCTGCTCTGAGTGAGGCTGG + Intronic
1181064235 22:20298288-20298310 CAAGGTGCACAGGGAGAAGCAGG + Intergenic
1181397610 22:22633062-22633084 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1181500358 22:23312432-23312454 CTGGGGGCCCAGAATGAACCTGG + Intronic
1181651796 22:24262996-24263018 CTGGGGGCCCAGAATGAACCTGG - Intergenic
1181705580 22:24647743-24647765 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1181930375 22:26396086-26396108 CAGGGTGCTCAGAACAAAGCAGG + Intergenic
1182057674 22:27372650-27372672 CAGGGTCCTCAGAGTGAAGGTGG + Intergenic
1183323229 22:37177642-37177664 CAGGCTGCAGAGGGTGAAGCTGG - Intergenic
1183419955 22:37705966-37705988 CAGGGTGGTGAGAGTGAATCAGG + Intronic
1183635818 22:39061987-39062009 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1183669004 22:39261208-39261230 CAGGCTGCACAGAGTGGAGCAGG + Intergenic
1183776640 22:39970553-39970575 CTGGGTCTCCAGAGTGACGCTGG + Intronic
1184094276 22:42308212-42308234 CAAGGTGCCTATAGTGAGGCGGG + Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184530842 22:45054483-45054505 AAGGGGGCACAGAGTGAAGCTGG + Intergenic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184691722 22:46120285-46120307 CAGGGAGCCCAGAGCGAGGCTGG + Intergenic
1185021520 22:48379496-48379518 CAGGGTGCCCACAGTAATGCTGG + Intergenic
949506925 3:4737337-4737359 CAGGCTCCCCAGAGAGATGCTGG - Intronic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
951298956 3:20971994-20972016 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
951762953 3:26164862-26164884 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
951894718 3:27599953-27599975 AAGGTTGCCCACAGTGAAGGAGG - Intergenic
952296668 3:32068453-32068475 AAGGTTGCCCATAGTGAAGGAGG - Intronic
952379794 3:32795913-32795935 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
952895411 3:38075506-38075528 AAGGTTGCCCATAGTGAAGGAGG + Intronic
952896204 3:38080726-38080748 AAGGTTGCCCATAGTGAAGGAGG + Intronic
953077278 3:39582266-39582288 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
953599584 3:44349477-44349499 AAGGTTGCCCATAGTGAAGGAGG + Intronic
953679955 3:45031562-45031584 CAGGCTGCCCAGTGCCAAGCTGG + Intronic
953787152 3:45920020-45920042 GAGGTTGCCCAGAGAAAAGCTGG - Exonic
954161950 3:48729236-48729258 AAGGTTGCCCATAGTGAAGGAGG + Intronic
954360872 3:50122215-50122237 CAGGGCTCCCAGATGGAAGCAGG + Intergenic
954369268 3:50161731-50161753 TAGGGTGCTCACAGTCAAGCTGG + Intronic
954391250 3:50269208-50269230 CAGGGTGCTCAGGGTTCAGCGGG - Exonic
954704187 3:52470270-52470292 CAGGGTCCCAAGAAAGAAGCGGG - Intronic
955922995 3:63977642-63977664 GATGGGCCCCAGAGTGAAGCAGG - Intronic
956505127 3:69929743-69929765 CAGAGTGCCAAGACAGAAGCAGG + Intronic
956933024 3:74067605-74067627 CATTTTGCCCAGATTGAAGCTGG + Intergenic
958038048 3:88192845-88192867 CAGGGTGCCCAGATTAAACATGG - Intergenic
958421807 3:93938994-93939016 AAGGTTGCCCATAGTGAAGGAGG - Intronic
958797284 3:98719171-98719193 CTGGGTGACAAGAGTGAAACTGG - Intergenic
959006617 3:101027047-101027069 CAGGCTGCCTAGAATGCAGCTGG - Intergenic
959543856 3:107571142-107571164 AAGGTTGCCCATAGTGAAGGAGG + Intronic
959930775 3:111979389-111979411 CGGGGTGCCCAGAATGCCGCAGG - Intronic
960310261 3:116109770-116109792 AAGGTTGCCCATAGTGAAGGAGG + Intronic
961263180 3:125618920-125618942 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
962022330 3:131513590-131513612 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
962321273 3:134392640-134392662 CACTGTGCTCAGAGTGAGGCTGG - Intergenic
962374781 3:134850773-134850795 CAGGGTATGGAGAGTGAAGCGGG - Intronic
963111995 3:141695762-141695784 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
963520293 3:146354789-146354811 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
963521473 3:146363290-146363312 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
963775365 3:149433694-149433716 CAGGCTGCCCAGATTCAAGGTGG - Intergenic
964176239 3:153828115-153828137 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
964983490 3:162713617-162713639 AAGGGTGCCCATAGTGAAGGAGG - Intergenic
965286878 3:166828558-166828580 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
965862129 3:173160401-173160423 AAGGCTGCCCATAGTGAAGAAGG + Intergenic
966232989 3:177670298-177670320 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
966397507 3:179518073-179518095 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
966398598 3:179525409-179525431 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
966806241 3:183810010-183810032 CAGGGAGCACAGAGGTAAGCAGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967104120 3:186241926-186241948 CAGAGTGCCCAGGCTGAGGCTGG + Intronic
967369677 3:188730301-188730323 AATGGTGCCCAGATTGAAACAGG + Intronic
967658260 3:192075546-192075568 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
968800626 4:2741257-2741279 CAGCGTGGCCAGAATAAAGCAGG + Intergenic
968969111 4:3784330-3784352 CAGGGAGCTCTGAGGGAAGCTGG - Intergenic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969592542 4:8130225-8130247 CAGGGTGGCCAGGGTGGTGCTGG + Intronic
969656072 4:8499269-8499291 CAGGGGGCCCAGGCTGAAGATGG - Intergenic
969827152 4:9766716-9766738 CAGTTTGCCCAGGATGAAGCCGG + Intergenic
969883688 4:10196668-10196690 CAGGGTGCCCCCAATAAAGCTGG + Intergenic
970638727 4:18039510-18039532 CATGGATCCCAGAGTGAAACAGG - Intergenic
972071286 4:35021275-35021297 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
972272539 4:37524968-37524990 CAGGGTGTCCAGATTTAAGATGG + Intronic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
973750974 4:54021039-54021061 AAGGTTGCCCATAGTGAAGAAGG - Intronic
973763993 4:54147351-54147373 CAGGGTTCTCCGAGTGAAGCTGG + Intronic
974490363 4:62557063-62557085 CTGGTTACCCAGAGTGATGCAGG + Intergenic
975131100 4:70833904-70833926 CAGTATGCCCAGAGTGAGCCTGG - Intronic
975151921 4:71032439-71032461 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
976558421 4:86475816-86475838 AAGGCTGCCCATAGTGAAGGAGG - Intronic
977446588 4:97139096-97139118 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
977656732 4:99530915-99530937 CAAAGTGGCCAGAGTGTAGCAGG - Intronic
978001262 4:103558218-103558240 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
978303381 4:107294924-107294946 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
978381695 4:108135518-108135540 CAGGATGGCGAGAGTGAAGGTGG + Intronic
980112076 4:128645298-128645320 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
980903786 4:138929114-138929136 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
981040108 4:140214807-140214829 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
981482869 4:145256019-145256041 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
981525057 4:145700367-145700389 AAGGTTGCCCATAGTGAAGGAGG - Intronic
982103507 4:151991500-151991522 TAGGGTGCTCAGTCTGAAGCTGG + Intergenic
983883919 4:172960879-172960901 AAGGCTGCCCATAGTGAAGGAGG + Intronic
985582204 5:704031-704053 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
986040189 5:3986675-3986697 CAGGGTGGCTAGAATAAAGCAGG + Intergenic
986564617 5:9099896-9099918 CAGAGTGTCGAGAGTGAAGCTGG - Intronic
986684192 5:10261263-10261285 CTGGGTTCCCAGAGTGAGGGAGG + Intronic
986732995 5:10649112-10649134 CAGGGTTCGCAGAGTGAACTAGG + Intronic
986981063 5:13448511-13448533 CAGGGTGCCTAGAATAAAGAAGG - Intergenic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
990565273 5:57021474-57021496 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
991021087 5:61980802-61980824 CAGGGTGCCCTGTGCCAAGCAGG - Intergenic
992452202 5:76885223-76885245 AAGGTTGCCCATAGTGAAGGAGG + Intronic
994126273 5:96171378-96171400 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
995125361 5:108573289-108573311 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
995652999 5:114392443-114392465 CTGGGTGGCCAGAGTGAACAGGG + Intronic
995769229 5:115651739-115651761 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996313095 5:122129056-122129078 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
996344971 5:122478079-122478101 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
996358780 5:122623366-122623388 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
997746258 5:136302543-136302565 AAGGTTGCCCATAGTGAAGGAGG - Intronic
998327869 5:141298130-141298152 CAGGGTGCCCCGTGTGAGGCTGG + Intergenic
1000885480 5:166743581-166743603 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1001284966 5:170416153-170416175 CAGCCTTCCCAGAGTGAGGCTGG - Intronic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1001564106 5:172688491-172688513 CTGGGTGCCCAGAGCAAAGCTGG + Exonic
1001724775 5:173887896-173887918 AAGGGTGCCCACAGTAAAGGTGG - Intergenic
1002607526 5:180391798-180391820 CAGGGTGCCCCAAGTTGAGCTGG + Intergenic
1002836496 6:869273-869295 CAGAGTGCCCAGCGTGGAGCAGG + Intergenic
1003145618 6:3508013-3508035 CAGGGCGCCCAGAGATGAGCAGG + Intergenic
1003851010 6:10222494-10222516 AAGGGAGCCCAGAGTGAAGAGGG + Intergenic
1005786730 6:29251709-29251731 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1007114104 6:39331083-39331105 CAAGGTGCAAAGAGAGAAGCAGG - Exonic
1007177748 6:39908342-39908364 CACGGTGCCCAGATTATAGCAGG - Intronic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1008476372 6:51939391-51939413 AAGGCTGCCCATAGTGAAGGAGG - Intronic
1009688380 6:66992426-66992448 GGGGGTGGCTAGAGTGAAGCTGG + Intergenic
1009750457 6:67873446-67873468 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1010071877 6:71753048-71753070 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1011771092 6:90674679-90674701 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1013408031 6:109860213-109860235 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1013808287 6:114017169-114017191 AAGGCTGCCCACAGTGAAGGAGG + Intergenic
1014115495 6:117664187-117664209 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1015801525 6:137065823-137065845 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1016114295 6:140261878-140261900 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1016518665 6:144924442-144924464 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1017923052 6:158887877-158887899 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1018084646 6:160291041-160291063 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1018495557 6:164343210-164343232 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1018521623 6:164656622-164656644 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1019217026 6:170450516-170450538 CAGAGCTCCCAGTGTGAAGCTGG - Intergenic
1019563015 7:1667261-1667283 CAGGCTGCCCAGGGAGGAGCAGG + Intergenic
1020541276 7:9462986-9463008 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1021393466 7:20121817-20121839 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1022372736 7:29786131-29786153 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1022447256 7:30480480-30480502 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1022616891 7:31940807-31940829 CAGGATGCTCAGAGTGAAACTGG - Intronic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1024984802 7:55185750-55185772 CAGGGTTCTCAGAATGAAACTGG + Intronic
1025029963 7:55548956-55548978 CAGGGTGACCACAGTGAGACTGG + Intronic
1026831483 7:73612887-73612909 CAGGGTGCCCACAGCTTAGCGGG + Intronic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1027354261 7:77340905-77340927 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1027858135 7:83539199-83539221 CTGGGAGCCCAGGGGGAAGCTGG + Intronic
1028690026 7:93641104-93641126 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1029316947 7:99724136-99724158 AAGGTTGCCCATAGTGAAGGGGG - Intronic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1029500063 7:100923378-100923400 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1031004525 7:116456762-116456784 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1032215359 7:129952948-129952970 CACGGCGCCCAGAGCGAGGCTGG - Exonic
1033084561 7:138330236-138330258 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1033676103 7:143541694-143541716 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1033695731 7:143787745-143787767 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1036472493 8:9063928-9063950 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1036590789 8:10166118-10166140 CTGGCTCTCCAGAGTGAAGCTGG - Intronic
1036693192 8:10957658-10957680 CATGCTGCCCAGAGTGAGACTGG - Intronic
1037548960 8:19951223-19951245 CAGGGTTCCCATTGTGAAGTAGG + Intronic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1041040675 8:53843183-53843205 CCGGGAGCCGAAAGTGAAGCGGG + Exonic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1042810956 8:72824558-72824580 GAGTGTGCCTAGGGTGAAGCAGG - Intronic
1043597607 8:81903017-81903039 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1044921839 8:97176336-97176358 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1046074746 8:109302052-109302074 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1048612045 8:136033589-136033611 CAGGGTGAAAAGAGTCAAGCAGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049569702 8:143363531-143363553 CAGGCTGCCAAGAGTGGAGGAGG - Intergenic
1051953551 9:22663004-22663026 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1052312124 9:27078833-27078855 TGGGGAGCCCAGAGTGTAGCTGG - Intergenic
1052720789 9:32168988-32169010 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1053009216 9:34623863-34623885 CTGGGTGCGTAGAGTGAAGGCGG + Exonic
1053060121 9:35024118-35024140 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1053070164 9:35096429-35096451 TAGGGTGCCCAGCGGGAGGCTGG - Exonic
1053118456 9:35526200-35526222 CAGGGTGCTCAAAATAAAGCAGG - Intronic
1053133988 9:35637892-35637914 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1053476330 9:38384548-38384570 AAGGAAGCCCAGAGGGAAGCAGG - Intergenic
1054146827 9:61568352-61568374 CTGGGTGACAAGAGTGAAACTGG + Intergenic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055800103 9:80025308-80025330 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
1056391723 9:86147015-86147037 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1057377837 9:94541082-94541104 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1057911402 9:99022876-99022898 CTGGGTGCCCAGAGTCCAGCAGG - Intronic
1058506777 9:105674302-105674324 CAGGGAGGCCAGAGTGATGGAGG + Intergenic
1060920126 9:127414534-127414556 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1061713881 9:132506491-132506513 CAGGGTGCCCAGAGTCCACCAGG - Intronic
1062271433 9:135711529-135711551 CAGGGTGCCTGGCGTGCAGCTGG + Intronic
1062295814 9:135825936-135825958 CAGGGAGCCCGGGGGGAAGCTGG + Intronic
1062404684 9:136389820-136389842 GAGGGTGGCTGGAGTGAAGCTGG + Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062501627 9:136854348-136854370 GTGGGGGCCCAGAGTGAGGCTGG + Intronic
1062529246 9:136992669-136992691 CAGGCTGTCCGGCGTGAAGCAGG - Exonic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1062638085 9:137501877-137501899 CAGGGTGCCCAGTGTCCATCAGG - Intronic
1187103919 X:16221296-16221318 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1187148285 X:16657431-16657453 CAGGGTGACCAAAGTGAACTGGG + Intronic
1188201161 X:27293997-27294019 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1188333178 X:28897094-28897116 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1188552500 X:31378754-31378776 AAGGTTGCCCATAGTGAAGGAGG - Intronic
1189031976 X:37460304-37460326 AAGGTTGCCCATAGTGAAGGAGG + Intronic
1191014349 X:55792778-55792800 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1191805964 X:65134136-65134158 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1193885785 X:86983046-86983068 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1194366955 X:93024174-93024196 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1194956460 X:100186804-100186826 GAGGGTGCCGAGAATGTAGCTGG - Intergenic
1195017105 X:100790919-100790941 AAGGTTGCCCATAGTGAAGAAGG + Intergenic
1196584964 X:117418873-117418895 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1196774000 X:119322217-119322239 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1196992852 X:121347485-121347507 AAGGCTGCCCATAGTGAAGGAGG + Intergenic
1197470809 X:126864333-126864355 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1198077980 X:133212769-133212791 CTGGGTGACAAGAGTGAGGCGGG + Intergenic
1198598307 X:138260026-138260048 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1198599538 X:138268763-138268785 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1199377781 X:147133605-147133627 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1199576330 X:149316917-149316939 AAGGTTGCCCATAGTGAAGGAGG - Intergenic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200812661 Y:7501600-7501622 AAGGCTGCCCATAGTGAAGGAGG - Intergenic
1201307652 Y:12564413-12564435 AAGGTTGCCCATAGTGAAGGAGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic