ID: 1154311864

View in Genome Browser
Species Human (GRCh38)
Location 18:13273173-13273195
Sequence AGCAAGGTTGGTTTTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154311858_1154311864 10 Left 1154311858 18:13273140-13273162 CCATCTGCAATGTTTCTGAAAAA No data
Right 1154311864 18:13273173-13273195 AGCAAGGTTGGTTTTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154311864 Original CRISPR AGCAAGGTTGGTTTTGGGAA GGG Intronic