ID: 1154315620

View in Genome Browser
Species Human (GRCh38)
Location 18:13301131-13301153
Sequence GTTTAGGGATGCTGCCTACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154315611_1154315620 30 Left 1154315611 18:13301078-13301100 CCGTGGTTGGGGGGGTACAGGTG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1154315620 18:13301131-13301153 GTTTAGGGATGCTGCCTACTCGG 0: 1
1: 0
2: 0
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154315620 Original CRISPR GTTTAGGGATGCTGCCTACT CGG Intronic
905487994 1:38319951-38319973 GTTTTGGGATTCTTCCTGCTTGG + Intergenic
909514870 1:76496087-76496109 GATTAAGGATGAGGCCTACTTGG + Intronic
911391248 1:97246657-97246679 GTGTAGGGATGTTGCCTCGTAGG + Intronic
921662454 1:217821143-217821165 GTTGAGAGATGGGGCCTACTGGG - Intronic
922581066 1:226698345-226698367 GGCTAGGGATGCTGACTGCTAGG + Intronic
924499490 1:244623908-244623930 GTTGATGGATGCTGACTAATTGG + Intronic
1070331100 10:75417906-75417928 TTTCAGGGAGGCTTCCTACTAGG + Intergenic
1073887172 10:108052865-108052887 ATTTAGAGGTGCTGCATACTGGG - Intergenic
1081093601 11:38902684-38902706 GTTTGGGAATGCAGCCTAGTAGG + Intergenic
1083102085 11:60319021-60319043 GCTGAGGTATGCTGCCTCCTAGG + Intergenic
1084090528 11:66876666-66876688 GTTATCGGATGCTGCCCACTAGG + Intronic
1088696142 11:112367537-112367559 GTGTTGGAATGCTGCCTTCTAGG + Intergenic
1090149715 11:124370237-124370259 ATTTAGGCATTCTGCATACTAGG - Intergenic
1091136716 11:133197815-133197837 GTTTGGGGAGGCGTCCTACTCGG - Intronic
1093980730 12:25472426-25472448 GTTTAGGGCAGCTGCTGACTGGG + Intronic
1102170807 12:110841268-110841290 GTTTAGGAATGCAGCCCAGTAGG + Intergenic
1106655162 13:31735514-31735536 GTTTATCTATGCTGCCTTCTGGG + Intergenic
1109066162 13:57695347-57695369 GTTTTGAGATGCTGCCAAATTGG + Intronic
1112617057 13:101016658-101016680 GTTCAGAGATGCTGCCTAAAGGG + Intergenic
1112681528 13:101771746-101771768 TTCTAGGGATTCTGCATACTTGG + Intronic
1115378887 14:32710984-32711006 GTTTAGGCATGCTGGCCACATGG - Intronic
1120460390 14:84787561-84787583 GAGTAGGGATGCTGCCAATTGGG - Intergenic
1120933946 14:89875122-89875144 GTTGGGGGATGCTGACTGCTCGG + Intronic
1121309331 14:92926718-92926740 GGTGAGGGCTGCTGCCTGCTGGG + Intronic
1130232705 15:82109032-82109054 CTTTAGGGCTGGGGCCTACTCGG - Intergenic
1144756884 17:17685314-17685336 GTGCAGGGATGCTTCCTGCTTGG - Intronic
1152012867 17:77729345-77729367 TGGTAGGGATGCTGCCTTCTTGG + Intergenic
1154315620 18:13301131-13301153 GTTTAGGGATGCTGCCTACTCGG + Intronic
1155412716 18:25563999-25564021 GATGAAGGCTGCTGCCTACTGGG - Intergenic
1159080310 18:63728766-63728788 GTTTAGGGACTCTGTCTCCTGGG - Intergenic
1161714196 19:5866330-5866352 GGCTGGGGATGGTGCCTACTGGG - Exonic
925371872 2:3351573-3351595 TTTCAGGGATGGTGCCTACAGGG - Intronic
928179494 2:29058013-29058035 ATTTAGGGATGCTGACTCCCAGG - Exonic
929635698 2:43518953-43518975 GTTTTGGGAGGCTGCCTAGCGGG - Intronic
929822293 2:45283116-45283138 GTTTTGTGATGCTGCCCTCTGGG - Intergenic
930033165 2:47070366-47070388 GATCAGGGATGCTGCCCACGTGG - Intronic
932060134 2:68488658-68488680 GATTTGGAGTGCTGCCTACTTGG + Intronic
933804026 2:85984925-85984947 GCTTGGGGATGCTGCATCCTAGG - Intergenic
940186037 2:150985775-150985797 GCTTGGGGATGTTGGCTACTGGG - Intergenic
940782253 2:157945234-157945256 GTGTAGTAATGCTGTCTACTTGG - Intronic
946336446 2:219040388-219040410 GTTTAGACATGTTGCCAACTAGG - Intronic
946469593 2:219946192-219946214 GTTCTGGGATGCTGCCAGCTGGG + Intergenic
1170882427 20:20308704-20308726 GTTTAGGAATGCTGACTGGTAGG + Intronic
1173452210 20:43175008-43175030 GTTTAGAGATGCTGTGAACTTGG - Intronic
1183467093 22:37985265-37985287 ATTTTGGGTTGCTACCTACTGGG + Intronic
1184126730 22:42492467-42492489 GTTTAGGGCCGCTGCGTCCTTGG - Intergenic
951860055 3:27242118-27242140 CTTTAGAGATCCTGCCTCCTTGG - Intronic
952973324 3:38671114-38671136 GTTGAGGGCTGCTCCCCACTTGG + Intergenic
953509303 3:43519186-43519208 CTTGAGGGATCTTGCCTACTGGG - Intronic
956235371 3:67064037-67064059 GTTTAGGCATGCTGCACACCTGG + Intergenic
964117762 3:153154687-153154709 GTTTAAGGAATCTGCCTAATAGG - Intergenic
971119359 4:23687084-23687106 TTTCAAGGCTGCTGCCTACTAGG + Intergenic
972649859 4:41006262-41006284 GTTTAGGCATGCTGTGTTCTGGG - Intronic
972881149 4:43424595-43424617 GTGTAGAAATGCTGCCTTCTTGG + Intergenic
978123473 4:105109407-105109429 GTTTTGGGAAGCAGCCTACACGG - Intergenic
979915940 4:126433495-126433517 GTTAAGGTATGCTATCTACTGGG + Intergenic
981898734 4:149835957-149835979 GATTGGAGTTGCTGCCTACTTGG + Intergenic
982996962 4:162361130-162361152 GACTTTGGATGCTGCCTACTTGG - Intergenic
984458326 4:179999979-180000001 GTTTGGGGAAGCTGCCAAGTAGG + Intergenic
985621282 5:957438-957460 GTCCAGGGATGCTCCCTGCTTGG - Intergenic
986278312 5:6301351-6301373 GTTTAGTGATGGTACCTACCAGG + Intergenic
989543402 5:42644121-42644143 ATTTAGGTATGCTGTCTTCTAGG + Intronic
997242914 5:132321174-132321196 GTCTAGGGCTGCTGCCTGCAGGG + Intronic
998743394 5:145229667-145229689 GGTAAAGGATGGTGCCTACTGGG - Intergenic
999178754 5:149653769-149653791 GTTTAAGAATGCAGACTACTTGG - Intergenic
1018174531 6:161167420-161167442 GTTTTGCCATGCTGCCTACTGGG + Intronic
1018741664 6:166733748-166733770 GTTTAGGGATGGCACCTACCAGG - Intronic
1019523315 7:1470085-1470107 GTCGGGGGATGCTGCCCACTTGG - Intergenic
1026284418 7:68950628-68950650 CCTTTGGGATGCTGCCTACTAGG + Intergenic
1027334079 7:77130002-77130024 GAGTAGTGATGCTGACTACTTGG + Intronic
1029781715 7:102741296-102741318 GAGTAGTGATGCTGACTACTTGG - Intergenic
1030447702 7:109668110-109668132 GGGTAGTGATGCTGCCAACTTGG - Intergenic
1030585308 7:111411550-111411572 GTTGAAGGATGGTGCCTGCTGGG - Intronic
1038394684 8:27238146-27238168 GTCTAGGGATGGTGCTTCCTAGG - Intronic
1038748802 8:30277600-30277622 GTTTAGGGATGCTAGCAGCTGGG + Intergenic
1040423060 8:47259109-47259131 GTTTAGGGAAGCTGGCCACCAGG + Intergenic
1043286249 8:78535409-78535431 GTTTAGGGATGGGGTCCACTTGG + Intronic
1047541384 8:125769733-125769755 GTTTCTGTATGCTGCTTACTAGG - Intergenic
1048695591 8:137024426-137024448 GTTGATTGATGCTGGCTACTGGG + Intergenic
1050616185 9:7404081-7404103 GTTGAGGGTTGCTGCTTCCTGGG - Intergenic
1052450198 9:28619694-28619716 GTGTGGCCATGCTGCCTACTAGG + Intronic
1055127353 9:72733928-72733950 GTTTAGTGATGCTGGCAATTTGG - Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1187258979 X:17667847-17667869 GCTTAGGGAAGCTGCCTCCAGGG - Intronic
1190429291 X:50363708-50363730 ATTTAGGATTGCTGCCTTCTTGG - Intergenic
1200058361 X:153473116-153473138 GGTCAGGGAGGCTGCCCACTTGG - Intronic
1201730232 Y:17194108-17194130 GTCCAGGCATGGTGCCTACTGGG + Intergenic