ID: 1154316658

View in Genome Browser
Species Human (GRCh38)
Location 18:13309692-13309714
Sequence GTGGAGTATTTCCTGTGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154316654_1154316658 25 Left 1154316654 18:13309644-13309666 CCTAGACCTTGATCACTTAAAAT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1154316658 18:13309692-13309714 GTGGAGTATTTCCTGTGGCTCGG 0: 1
1: 0
2: 1
3: 13
4: 171
1154316655_1154316658 19 Left 1154316655 18:13309650-13309672 CCTTGATCACTTAAAATAAGATC 0: 1
1: 0
2: 0
3: 16
4: 239
Right 1154316658 18:13309692-13309714 GTGGAGTATTTCCTGTGGCTCGG 0: 1
1: 0
2: 1
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154316658 Original CRISPR GTGGAGTATTTCCTGTGGCT CGG Intronic
902757938 1:18561768-18561790 GTGGAGTAGTTCCTGGAGCCCGG - Intergenic
903457322 1:23496681-23496703 GAAGAGGATTCCCTGTGGCTGGG + Intergenic
903905919 1:26686459-26686481 TGGGAGTATTTCCTGGGGCCTGG - Intergenic
904129588 1:28265750-28265772 GTGGAGGATCACCTGAGGCTAGG - Intronic
904145488 1:28387657-28387679 CTGGAGGATTGCCTGAGGCTAGG + Intronic
905570630 1:39001630-39001652 GTGGAGTACTTCTTGAGGCCTGG - Intronic
905804151 1:40863772-40863794 CTGGAGTCTTTCCTGTGGCCAGG + Intergenic
905880240 1:41458292-41458314 GTTGAGGCTTTCCTGTGGCAAGG + Intergenic
909708963 1:78622184-78622206 GTGTGATATTTCCTGTGCCTAGG + Intronic
910017866 1:82549772-82549794 GTGTTGTATCTCCTGTTGCTTGG - Intergenic
910756539 1:90699099-90699121 GTGGAGGATTTCTTGCGGCCAGG - Intergenic
915035233 1:152918044-152918066 CTGGAGAATTTCCTTTTGCTCGG + Intergenic
916201049 1:162272078-162272100 GTGGAGGATTGCCTGAGGCCAGG - Intronic
916310651 1:163395192-163395214 GTGGAGGAAGTCTTGTGGCTAGG + Intergenic
917648219 1:177049217-177049239 GTGGGCTATGTCCTGTGCCTTGG - Intronic
920969112 1:210727424-210727446 GTGGAGGATTTCTTGAGGCCAGG - Intronic
1065849512 10:29775601-29775623 CAGGAGTATTTCTTGAGGCTAGG - Intergenic
1066650573 10:37651282-37651304 ATGGACTATTTCCTGTCGCGTGG - Intergenic
1067721306 10:48729589-48729611 GGTGAGTCTTTCCTGTGTCTGGG + Exonic
1069015756 10:63427300-63427322 GTGAAGTATTTCCTGGGCCAGGG + Intronic
1072076225 10:91976743-91976765 TTGGATTATTTCCAGTGGCCAGG + Intronic
1072601790 10:96938042-96938064 CAGGAGTATTTCCTGAGCCTGGG - Intronic
1073541594 10:104319734-104319756 GGGCAGTGTTTCCTGTGACTGGG - Intronic
1075592665 10:123703793-123703815 GTGGAGTGTGCCCTGAGGCTTGG + Intergenic
1076487684 10:130835302-130835324 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1076487745 10:130835499-130835521 GTGGGGTACTACCTGTGGGTGGG - Intergenic
1076487781 10:130835607-130835629 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1076487852 10:130835875-130835897 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1078543558 11:12230005-12230027 ATGGAGCACTTCCTGTGGGTGGG + Intronic
1082967765 11:58985257-58985279 GTGGTGTTATTCCTGAGGCTAGG + Intronic
1083070869 11:59979632-59979654 GTGGAGTGTTTTCCTTGGCTGGG - Intergenic
1084580518 11:70020272-70020294 GTGGGGGATTTCCTGTGGATAGG - Intergenic
1085016403 11:73176993-73177015 GTGGAGTCCTTCCTGAGGCAGGG + Intergenic
1088246074 11:107819584-107819606 GTGGTGAATTTCCTTTGTCTAGG - Intronic
1091654090 12:2332458-2332480 GCCAAGTCTTTCCTGTGGCTAGG - Intronic
1094096062 12:26706133-26706155 GTGCATTATTTCGTGTGGCGTGG + Intronic
1096265930 12:50122624-50122646 GTGGAGGATTGCCTGAGCCTAGG + Intergenic
1096359559 12:50972179-50972201 GTAGAATATTTCCAGTGGCCTGG - Intergenic
1096870066 12:54587674-54587696 GTGGAGTCTTTCCAGGGGCTGGG - Intronic
1098376960 12:69826201-69826223 ATGGGGTAGTTTCTGTGGCTTGG + Intronic
1098986670 12:77019856-77019878 ATGCAGCATTTCCTGTGACTAGG - Intergenic
1104624659 12:130341194-130341216 GTGGAGGATTTCATGTGGGCAGG - Intronic
1107037631 13:35917792-35917814 GCAGAGCATTTCCTGTGGCGGGG + Intronic
1107484449 13:40813081-40813103 ATGGAGGATCTCCTGTGCCTGGG - Intergenic
1111611306 13:90611587-90611609 GTGGGGCATTGACTGTGGCTTGG - Intergenic
1116536062 14:46031866-46031888 GTTGCCTATTTCCTTTGGCTGGG + Intergenic
1118696422 14:68390608-68390630 GTAGAGAATATACTGTGGCTGGG + Intronic
1119330335 14:73788535-73788557 GTGGAGGATTTCATGTTGCTAGG - Intronic
1119674312 14:76542385-76542407 GTGCAATATTTCAAGTGGCTGGG - Intergenic
1121162553 14:91758324-91758346 CTGGAGAATTTCCTCTGGCTTGG - Intronic
1121191508 14:92034859-92034881 GTGGAGGATTCCCTAAGGCTAGG - Intronic
1122859858 14:104577670-104577692 GCGGAGCATGTCCAGTGGCTGGG - Intronic
1124934456 15:34157083-34157105 GTGGAGAGTTGCCTCTGGCTTGG + Intronic
1126061507 15:44787057-44787079 TTGCTGTGTTTCCTGTGGCTAGG - Intergenic
1128042478 15:64587611-64587633 ATGGAGTACTTCCTGTGGTCAGG + Intronic
1130192943 15:81753652-81753674 GTGGAGTCTGTCCTGTGCATTGG - Intergenic
1130706640 15:86239066-86239088 GTAGAGAAATTCCTGTGGTTTGG + Intronic
1135026257 16:19001588-19001610 GAGGAGTATTGCCTGAGCCTGGG + Intronic
1135329580 16:21550138-21550160 GTGAAGGATTTCCTGGGGCCTGG - Intergenic
1135647884 16:24179215-24179237 ATGGAATATTTCCATTGGCTGGG + Intronic
1135846409 16:25922601-25922623 GTTGAGCAATTACTGTGGCTTGG + Intronic
1135852903 16:25980775-25980797 GTGGTGTGCTTCCTGTGTCTAGG - Intronic
1136339918 16:29636093-29636115 GTGAAGGATTTCCTGGGGCCTGG - Intergenic
1137542418 16:49373916-49373938 GTGGAGTCTTGCTAGTGGCTTGG - Exonic
1138242555 16:55439426-55439448 GTGGAGTGTCTCCTGTGTTTTGG - Intronic
1139126440 16:64083664-64083686 CTGGAGAATTCCCTGTTGCTTGG - Intergenic
1139470600 16:67176214-67176236 ATGGTCTACTTCCTGTGGCTGGG - Exonic
1141866942 16:86756833-86756855 GTGGAGTACTTTCTGTGGCTGGG + Intergenic
1142042595 16:87904669-87904691 GTGAAGGATTTCCTGGGGCCTGG - Intronic
1143452745 17:7045527-7045549 GTGGAGTATTGCTTGAGCCTGGG - Intergenic
1148455741 17:47810542-47810564 CTGAAGGATTGCCTGTGGCTTGG + Intronic
1148866523 17:50631585-50631607 TCGGAGCATTTCCTGTGCCTGGG + Intergenic
1151282809 17:73089259-73089281 GTGGAGTTTACCCTTTGGCTGGG - Intronic
1152995662 18:404192-404214 CTGAAATAATTCCTGTGGCTTGG + Intronic
1154316658 18:13309692-13309714 GTGGAGTATTTCCTGTGGCTCGG + Intronic
1155274796 18:24176516-24176538 GTTGAGATTTTCCTGTTGCTTGG + Intronic
1155465077 18:26125415-26125437 GTGGAGGATTTCCTGAAGCCAGG - Intergenic
1156135397 18:34031826-34031848 GAAGAGGCTTTCCTGTGGCTTGG - Intronic
1157241721 18:46016117-46016139 GTGAAGAATTTCTTGTGCCTGGG - Intronic
1159533083 18:69680300-69680322 GGGGAGGATTTCCTGTCCCTGGG + Intronic
1162283556 19:9719947-9719969 GTGGAGTGTTACCTCTGGCTTGG - Intergenic
925836744 2:7953615-7953637 GTGGACCACCTCCTGTGGCTTGG + Intergenic
926121626 2:10244130-10244152 GTCTGGTTTTTCCTGTGGCTCGG + Intergenic
927846755 2:26476244-26476266 GTGGAGCTGTACCTGTGGCTGGG - Exonic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928879390 2:36080456-36080478 GTTGAGTATTTACTGTGTATAGG - Intergenic
931382111 2:61763890-61763912 GTGGCGTGTTTCCGGTAGCTGGG - Intergenic
931677893 2:64716373-64716395 GGGAAGTCTTTCCTGTTGCTGGG + Intronic
932977558 2:76622608-76622630 TTGGAATATTTTCTGTGGGTAGG + Intergenic
934672853 2:96226652-96226674 GTGGAGGATTACCTGAGGTTAGG - Intergenic
935106834 2:100052610-100052632 GTGGAGCAGTTCCTCTGTCTGGG - Intronic
935605182 2:104965325-104965347 GTGGAGTATTGCCTAAGCCTGGG - Intergenic
935958718 2:108402958-108402980 GTGGAGAGTTTCCTCTGGCTTGG - Intergenic
940127394 2:150342051-150342073 CTTGAATATTTCCTGTGGCATGG + Intergenic
940935873 2:159494632-159494654 ATGGAGTATTTAATTTGGCTGGG + Intronic
941460005 2:165759391-165759413 CTGGAGTCTTTCATTTGGCTGGG - Exonic
942960419 2:181823738-181823760 GTGGAGGATTTCTTGTGGCCAGG - Intergenic
945164251 2:206925404-206925426 CTGAAATATTTCCTGAGGCTCGG + Intergenic
946558192 2:220883144-220883166 GTTGAGCATCTACTGTGGCTGGG - Intergenic
1173027914 20:39326414-39326436 CTGGAATATATCTTGTGGCTGGG - Intergenic
1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG + Intergenic
1176043662 20:63081393-63081415 GTGGAGTGGTTCCTGTTCCTGGG + Intergenic
1176115956 20:63432009-63432031 GTGGAGCCTTCCCTGTGGATGGG - Intronic
1177417324 21:20811506-20811528 GTTGAGTGTTTTCTCTGGCTGGG - Intergenic
1178399365 21:32271671-32271693 GTGGAGGATTGCTTGAGGCTAGG - Intronic
1180985000 22:19898897-19898919 GTGGAGGATCTACTGTGCCTGGG - Intronic
950860848 3:16146163-16146185 ATGGAGTCATTCCTGTGGCCAGG + Intergenic
956169803 3:66424123-66424145 GTGGGGTCTTCCCAGTGGCTGGG - Intronic
956606345 3:71076585-71076607 GTGAAGGATTTGGTGTGGCTGGG + Intronic
958842795 3:99228505-99228527 GAGAAGACTTTCCTGTGGCTTGG + Intergenic
959928962 3:111957767-111957789 GATGGTTATTTCCTGTGGCTAGG + Intronic
962101339 3:132345981-132346003 TTGGACCATCTCCTGTGGCTTGG - Intronic
963106680 3:141653535-141653557 GAGGAGGTTTTCCTGGGGCTGGG - Intergenic
964119420 3:153166799-153166821 ATGTAATATTTCCTGTGGTTGGG + Exonic
969338841 4:6527956-6527978 GTGGATCATGTCCTGGGGCTTGG - Intronic
969863152 4:10053377-10053399 GTGGAGTATTGCTTGAGGCCAGG + Intronic
971181274 4:24330543-24330565 ATGGAGCTTCTCCTGTGGCTGGG - Intergenic
972295081 4:37729686-37729708 GGGGAGTTTTTCCTCTGGTTGGG + Intergenic
972647663 4:40984453-40984475 GTGGAGGAGTTCCTTTGGCCAGG - Intronic
972902331 4:43700361-43700383 TAGCAGTATTTCCTGTGGCCAGG - Intergenic
975207115 4:71657750-71657772 GTGAAGCATTTCCTGAGCCTAGG - Intergenic
975383414 4:73728091-73728113 GTGTATTATTTCCTATGGCAGGG - Intergenic
979111287 4:116761270-116761292 GTGGAGTATTCCCCTTTGCTAGG - Intergenic
979229758 4:118334626-118334648 TTGGAGTAATTCCTCTGGATTGG - Intronic
980022351 4:127724549-127724571 GTGGAGAATTTTCTTTGGCTGGG + Exonic
980681857 4:136172875-136172897 GTGGGGATTTGCCTGTGGCTTGG - Intergenic
980741899 4:136961927-136961949 GTGGACTATTTTGAGTGGCTGGG - Intergenic
982463514 4:155701554-155701576 GTGGAGTATCTCCAGTAGCATGG + Intronic
983351781 4:166599284-166599306 ATGGAGAATTTTCCGTGGCTGGG - Intergenic
986746618 5:10750427-10750449 GACGACTATTTCCTCTGGCTTGG + Intronic
988018753 5:25596432-25596454 GTGGAGAAATACCTGTGACTGGG + Intergenic
988231428 5:28484265-28484287 GTGCAGTATTTACTGTCACTGGG + Intergenic
989504793 5:42215286-42215308 TTGTAGTATTCCCTGTGGCCTGG - Intergenic
989515287 5:42336687-42336709 CTAGAGGATTTCCTGTGGCTTGG - Intergenic
990852347 5:60220946-60220968 GAGGATTATTTCCTTGGGCTAGG - Intronic
991121594 5:63021711-63021733 ATAGAATATTTCCTGTGGCCTGG + Intergenic
991515968 5:67435871-67435893 ATGGGGTATATCCTGTGGCAGGG + Intergenic
992860018 5:80900111-80900133 GTGGAGTATTTCTTGTAGCCAGG + Intergenic
993553741 5:89308885-89308907 GAGTTATATTTCCTGTGGCTTGG - Intergenic
994968729 5:106708116-106708138 GGGGAGGATTTTCTGTTGCTAGG + Intergenic
994999790 5:107112786-107112808 GTGGCATATTTCATTTGGCTGGG - Intergenic
995448659 5:112275848-112275870 ATGGTATATGTCCTGTGGCTGGG - Intronic
997883197 5:137608913-137608935 GTTAATTTTTTCCTGTGGCTTGG + Intergenic
998355409 5:141531400-141531422 GTGGAGGATTGCTTGAGGCTGGG - Intronic
999606785 5:153325250-153325272 GCGGATTATTTCATGTGACTTGG + Intergenic
1004561637 6:16758568-16758590 GTGGAGTCTCTCGTCTGGCTTGG + Intronic
1005175154 6:23036235-23036257 GTGGTGTATTTTCTGTGTGTAGG + Intergenic
1009690411 6:67024536-67024558 GTGGAGGATTGCTTGTGCCTGGG + Intergenic
1012016252 6:93856128-93856150 GTGGACTATTTGCTATGGTTTGG + Intergenic
1013303591 6:108827234-108827256 GTGGTGGATTTCCAGTGGTTGGG + Intergenic
1015606324 6:134958592-134958614 GAGGAGTTTTACCTGTGGCTAGG - Intergenic
1016577513 6:145585936-145585958 CTGGAGTAGTTCCTGTTTCTAGG - Intronic
1020566501 7:9803423-9803445 ATGGATTATTACCTGTGGGTGGG - Intergenic
1023011171 7:35925936-35925958 GTGGAGAATTTCTTGAGCCTGGG + Intergenic
1025124812 7:56336028-56336050 GTGGAGAATTTCTTGAGCCTGGG + Intergenic
1027256241 7:76432541-76432563 CTGGAGGATTGCCTGAGGCTAGG - Intronic
1029863395 7:103600123-103600145 GTGGAGTATCACTTGAGGCTAGG - Intronic
1030710071 7:112739554-112739576 ATGGAGTTATTACTGTGGCTGGG + Intergenic
1031563295 7:123264157-123264179 GTGCAGTATTTCCAGTGCCTGGG + Intergenic
1032015877 7:128380233-128380255 GAGGAGTCTTACCAGTGGCTGGG + Intergenic
1033910410 7:146257084-146257106 GTCAACTATTGCCTGTGGCTAGG - Intronic
1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG + Intergenic
1038300764 8:26345169-26345191 GTGGAGAATTTCTTGGGGATAGG - Intronic
1050625966 9:7503976-7503998 GTGGAGTTTTCCCTGTGGTGAGG + Intergenic
1053032202 9:34790073-34790095 GTGGAGGATCGCCTGAGGCTAGG - Intergenic
1053464392 9:38294786-38294808 GTGGAATATTTCCTAAGTCTGGG - Intergenic
1054831840 9:69633795-69633817 ATTGAGTATTATCTGTGGCTTGG - Intronic
1056286487 9:85092421-85092443 GTGGAGTATTTGCTGTATCCCGG - Intergenic
1056578603 9:87873854-87873876 GTGGAGTTTTCCCTGGGGTTGGG - Intergenic
1058307316 9:103460006-103460028 GAGGAGTATTTCCTGCCGATGGG + Intergenic
1060814829 9:126629548-126629570 GTGGAGTCTGGCCTCTGGCTGGG + Intronic
1061424785 9:130492185-130492207 TTGGAGTCTTGCCTCTGGCTGGG + Intronic
1185842253 X:3402775-3402797 GTGGAGGAATACCTGAGGCTGGG - Intergenic
1185847722 X:3454604-3454626 ATGGGGTATGTCCTGGGGCTGGG - Intergenic
1189152403 X:38721672-38721694 ATGTAGTATTTACTGTGGATGGG + Intergenic
1189224057 X:39397966-39397988 GTGGGGTAATTGCTGTTGCTGGG + Intergenic
1193109978 X:77719025-77719047 GTGGAGGATTTCTTGAGGCCAGG - Intronic
1194754126 X:97717178-97717200 CTGGAGTATTACCCATGGCTGGG - Intergenic
1195443169 X:104921085-104921107 CTGGAGGAATTCCTGTAGCTAGG - Intronic
1195783095 X:108485677-108485699 GAGGAGTTTTGCCTGTGTCTGGG - Intronic
1198278631 X:135120698-135120720 GGTGGGTATATCCTGTGGCTGGG + Intergenic
1198292330 X:135251818-135251840 GGTGGGTATATCCTGTGGCTGGG - Intronic
1199331230 X:146562105-146562127 AAGGGATATTTCCTGTGGCTTGG + Intergenic
1200522328 Y:4225958-4225980 GTGCAGTATTTATTGTTGCTGGG + Intergenic
1200816139 Y:7534860-7534882 ATAGGGTATTTCCTGGGGCTGGG + Intergenic
1202116104 Y:21469933-21469955 GTGCAGTATTTCAGGTGACTGGG - Intergenic