ID: 1154317776

View in Genome Browser
Species Human (GRCh38)
Location 18:13319055-13319077
Sequence GAATGACCTCACCCACTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154317776 Original CRISPR GAATGACCTCACCCACTAAA TGG (reversed) Intronic
900838750 1:5029645-5029667 GAATGAGCTCAATCACTAATTGG - Intergenic
900931799 1:5742458-5742480 CAATGACCTCACCCATTATGAGG - Intergenic
913613967 1:120537802-120537824 GAATGCCATTACCCACCAAAAGG + Intergenic
914349065 1:146824031-146824053 TACTGATCTCACCCACAAAACGG - Intergenic
914373161 1:147049355-147049377 GAATGCCATTACCCACCAAAAGG + Intergenic
914576300 1:148973091-148973113 GAATGCCATTACCCACCAAAAGG - Intronic
917387921 1:174497587-174497609 GAAAGACCTCAGGCAATAAAAGG - Intronic
920276958 1:204813658-204813680 GAATGACCTTCCCCACAGAAAGG + Intergenic
921959917 1:221023863-221023885 GAATGAGCTCACCAAGTGAATGG - Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1064968526 10:21039827-21039849 CAATGCCCTGACCCAGTAAATGG + Intronic
1072830050 10:98647920-98647942 GAATCATCTAACCTACTAAAGGG + Intronic
1074290037 10:112131525-112131547 GAATGACATCACCCAAGAAAGGG - Intergenic
1076765963 10:132633215-132633237 CAAGCACCTCGCCCACTAAAGGG - Intronic
1084342680 11:68517439-68517461 AAATTACATCCCCCACTAAAAGG + Intronic
1086419315 11:86622774-86622796 GGATGAACTCACCAAATAAAAGG - Intronic
1086724458 11:90165748-90165770 AAATGACCTCACCCACCACAGGG - Intronic
1091157734 11:133389145-133389167 GTATGAGGTCACCCCCTAAAGGG - Intronic
1091358059 11:134953574-134953596 GAATGACATCACCCAGGGAAAGG - Intergenic
1091358070 11:134953620-134953642 GAATGACATCACCCAGGGAAAGG - Intergenic
1091358081 11:134953666-134953688 GAATGACATCACCCAGGGAAAGG - Intergenic
1091358092 11:134953712-134953734 GAATGACATCACCCAGGGAAAGG - Intergenic
1093231024 12:16542021-16542043 GAATGAAATCACAAACTAAAAGG - Intronic
1095148669 12:38763492-38763514 GAAAGAACCCACACACTAAATGG - Intronic
1096561020 12:52436086-52436108 CAATGCCCTCATCCACGAAATGG - Intergenic
1099862931 12:88242261-88242283 GAAAGAACTAACCCACCAAATGG - Intergenic
1101734766 12:107454668-107454690 GAAGGACCCCACCCACTCGAGGG - Intronic
1104296443 12:127519048-127519070 CCCTGACCTCACCCACTAACAGG + Intergenic
1104520934 12:129474364-129474386 CAATGACTTCACCCAGTTAATGG - Intronic
1117557285 14:56898741-56898763 CAATTACCTCAGCCTCTAAAGGG + Intergenic
1121225582 14:92319528-92319550 GGAGGCCTTCACCCACTAAAAGG + Intergenic
1127237642 15:57072263-57072285 GACTCACTTCACCCACAAAATGG + Intronic
1129256293 15:74335924-74335946 GAGTGCCCTCACCCACTCCATGG + Exonic
1132437484 15:101820971-101820993 TAATGACGTCACCCAGTAGAGGG - Intergenic
1133614202 16:7461015-7461037 TAAAGACCTCACTCACTACATGG - Intronic
1134568491 16:15271545-15271567 TAATGACCACAGCCAGTAAATGG - Intergenic
1134733941 16:16484817-16484839 TAATGACCACAGCCAGTAAATGG + Intergenic
1134933560 16:18227465-18227487 TAATGACCACAGCCAGTAAATGG - Intergenic
1139647310 16:68340860-68340882 GAGCTACCTCACCCACTGAAAGG - Intronic
1139984968 16:70891524-70891546 TACTGATCTCACCCACAAAACGG + Intronic
1140894122 16:79310176-79310198 GATTGACCTCATGCACAAAAGGG - Intergenic
1143225546 17:5299322-5299344 AAATGACATTCCCCACTAAAAGG - Intronic
1144557362 17:16294103-16294125 GATTGATCTCACCCACTATCAGG - Intronic
1150910829 17:69385592-69385614 GAATGCCCTCCCCCACAAAATGG - Intergenic
1151690825 17:75684176-75684198 GAAGCAGCTCACCCAATAAATGG - Intronic
1154317776 18:13319055-13319077 GAATGACCTCACCCACTAAATGG - Intronic
1154496852 18:14967568-14967590 GAATGACATCACCCAGGGAAAGG + Intergenic
1159467698 18:68805716-68805738 ATATGACCTCACCCACTCACTGG - Intronic
1161158353 19:2747041-2747063 AAATGTCTTCACCCACTCAATGG + Intergenic
1168649013 19:58081110-58081132 TAATGCCATTACCCACTAAAAGG + Intronic
927868743 2:26609937-26609959 GGATGAAGTCACCCACTCAAGGG + Intronic
929503907 2:42513449-42513471 CAATGACTTCACCCAGGAAAAGG + Intronic
930520774 2:52464180-52464202 GACTGAACTCACCCAGTAACTGG + Intergenic
932300243 2:70661927-70661949 CAATTTCCTCACCCACAAAATGG + Exonic
941989499 2:171541290-171541312 GAATGAGATCACCCACAAGAGGG + Intronic
1172216448 20:33239086-33239108 GAATGGCCTCACCCATCAAATGG + Intronic
1174109057 20:48185170-48185192 ACATGACCTCACCTAGTAAAGGG - Intergenic
1174525345 20:51166002-51166024 AAATGAGTTCACCCAATAAATGG + Intergenic
1178762308 21:35414924-35414946 AAATGCCATCCCCCACTAAAAGG + Intronic
1179606674 21:42520748-42520770 GCATGGCATCTCCCACTAAAAGG + Intronic
1184110639 22:42392105-42392127 AAATGACATCACCCAGTGAAGGG + Intronic
949123278 3:413621-413643 GAATGAACTAAAGCACTAAATGG + Intergenic
951449092 3:22816318-22816340 AAATGACTTCATCCAATAAAAGG + Intergenic
960022940 3:112975892-112975914 GAATGCCCTCACCCCCAACAAGG - Intergenic
963260941 3:143190220-143190242 GGATGCCGTCATCCACTAAAAGG - Intergenic
966768703 3:183484925-183484947 TAATTTCATCACCCACTAAATGG - Intergenic
971036248 4:22695969-22695991 AAATGACCATTCCCACTAAATGG - Intergenic
981536399 4:145804658-145804680 AAATGACCACAGCCACTGAAGGG - Intronic
993230351 5:85227212-85227234 GAATGAGGTCAACCACAAAAAGG - Intergenic
998804950 5:145909042-145909064 CAATCACCTCATCCACAAAATGG + Intergenic
1001805495 5:174582310-174582332 AAAAAACCTCACCCACAAAAAGG + Intergenic
1004872838 6:19924432-19924454 GAAGGACCTCAACCATTCAATGG + Intergenic
1005588006 6:27295874-27295896 GAAAGGACTTACCCACTAAATGG + Intronic
1005890965 6:30137360-30137382 AAATGCCCTCAGCCACTACAAGG + Exonic
1011335097 6:86251484-86251506 GAATGCCCTGAACCACTGAAGGG + Intergenic
1013324789 6:109033989-109034011 CAATGTCCTCACCCACACAATGG + Intronic
1014420917 6:121244783-121244805 GAAAGACCTCTCCCACAAATTGG - Intronic
1014974802 6:127866572-127866594 GAGTGAGCTCATCCACCAAAGGG - Intronic
1023614990 7:42010860-42010882 AAATGACCTAACCAACTACAAGG - Intronic
1024976741 7:55120340-55120362 GAATAACTTCACTTACTAAAGGG + Intronic
1037046250 8:14307952-14307974 TAATGTCTTCACCCCCTAAAAGG - Intronic
1039156085 8:34559131-34559153 GAATGTTCTTTCCCACTAAAAGG - Intergenic
1039905789 8:41785618-41785640 GAGTGACCACACCCACAAGAGGG - Intronic
1040826069 8:51622179-51622201 GAATAACCTCACCCACTGGCCGG + Intronic
1043695753 8:83215131-83215153 GAAAGACCTCTACCACTGAAAGG + Intergenic
1044203562 8:89464870-89464892 TCATCTCCTCACCCACTAAAGGG - Intergenic
1045199500 8:99966021-99966043 GAATGATCTTATGCACTAAAAGG + Intronic
1046449756 8:114372967-114372989 GAAGGACCTTACCCACAATAGGG + Intergenic
1048782253 8:138015226-138015248 GAATTTCCTCAACCACTAAAAGG + Intergenic
1057969143 9:99536667-99536689 AAAAGAGCTCTCCCACTAAATGG + Intergenic
1059584731 9:115593715-115593737 GACTGAAATCACCCACTAGATGG + Intergenic
1060161978 9:121372209-121372231 AAATGACCCCACCGACTGAATGG - Intergenic
1186380322 X:9051661-9051683 GTTTGACCACACCCATTAAAGGG + Intronic
1186447783 X:9646552-9646574 AACTGACCTCAGCCTCTAAAGGG - Intronic
1187523312 X:20032447-20032469 AAATGTCCTCAGCCACCAAAGGG + Intronic
1190853353 X:54268210-54268232 AAATTACATTACCCACTAAAAGG + Intronic
1192131112 X:68551530-68551552 GAATGTCCTCAACCGATAAAGGG + Intergenic
1196516987 X:116625559-116625581 GAAAGACCACACTCAATAAAAGG + Intergenic
1197293864 X:124693122-124693144 AAATGACTCCTCCCACTAAAAGG + Intronic