ID: 1154322011

View in Genome Browser
Species Human (GRCh38)
Location 18:13361819-13361841
Sequence TGCCCCCAGCCAGCCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154322007_1154322011 12 Left 1154322007 18:13361784-13361806 CCTAGCATGATGTCAGCTGCATT No data
Right 1154322011 18:13361819-13361841 TGCCCCCAGCCAGCCAGAGCAGG No data
1154322006_1154322011 16 Left 1154322006 18:13361780-13361802 CCATCCTAGCATGATGTCAGCTG No data
Right 1154322011 18:13361819-13361841 TGCCCCCAGCCAGCCAGAGCAGG No data
1154322005_1154322011 21 Left 1154322005 18:13361775-13361797 CCTCTCCATCCTAGCATGATGTC No data
Right 1154322011 18:13361819-13361841 TGCCCCCAGCCAGCCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154322011 Original CRISPR TGCCCCCAGCCAGCCAGAGC AGG Intronic