ID: 1154322828

View in Genome Browser
Species Human (GRCh38)
Location 18:13368403-13368425
Sequence AAAGCAGGCATCCCTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154322828 Original CRISPR AAAGCAGGCATCCCTGAGAC AGG (reversed) Intronic
900375603 1:2353147-2353169 CAAGCAGGCAGCGCTGTGACTGG + Intronic
900423076 1:2564124-2564146 ACAGCAGGCGTCACTGATACTGG - Intronic
900607940 1:3532034-3532056 AAAGCTGGCATCCCTGCAGCAGG + Intronic
902674145 1:17996777-17996799 AATGAAGACATACCTGAGACTGG + Intergenic
903483308 1:23670361-23670383 AATGAAGACATACCTGAGACTGG + Intergenic
904453358 1:30631136-30631158 AAAGATGACATACCTGAGACTGG - Intergenic
906669874 1:47646526-47646548 TAAGGAGGCAGCCCTGGGACTGG + Intergenic
908117690 1:60956312-60956334 AAAGCAAGCTTTCCTGAGAGTGG - Intronic
908963357 1:69728868-69728890 AATGAAGACATACCTGAGACTGG + Intronic
910600215 1:89023258-89023280 AAAGCAGTCAGCACTGAGCCTGG - Intergenic
912405674 1:109435538-109435560 AAAAAAGACATACCTGAGACTGG + Intergenic
912649209 1:111423318-111423340 AGAGAAGGCATCCCTTAGGCTGG + Intronic
912865138 1:113249731-113249753 CAATGAGGAATCCCTGAGACAGG - Intergenic
912925357 1:113908037-113908059 AAAGGAGCCAGCCCTGACACTGG + Exonic
912932184 1:113973673-113973695 AATGCAGTCAACACTGAGACAGG - Exonic
913186470 1:116373890-116373912 TGAGCCGGCATCCCTGAGCCTGG + Exonic
913379215 1:118190031-118190053 AAATCATGCATCCCTGAAAGTGG - Intergenic
913704906 1:121410907-121410929 AAAGCAGCCATAAGTGAGACAGG + Intergenic
914253697 1:145943402-145943424 AAAGGAGCTATCCCTGAGAAGGG + Intronic
914508562 1:148310154-148310176 AAAGCGGGGAACCCTCAGACCGG - Intergenic
915858767 1:159419554-159419576 AATAAAGGCATACCTGAGACTGG - Intergenic
915988525 1:160490342-160490364 AGGGCAAGCAGCCCTGAGACAGG + Intronic
916770367 1:167901922-167901944 AAAGGAGGCATCCTAGAGAAGGG - Intronic
917821095 1:178765143-178765165 AAAAAAGACATACCTGAGACTGG - Intronic
920897203 1:210065525-210065547 AAAAAAGACATACCTGAGACTGG - Intronic
922551203 1:226495828-226495850 ACAGCAGGGTTCCCTGAGCCAGG + Intergenic
924027544 1:239850964-239850986 ATATCAGACATCCCTGACACAGG + Intronic
924126578 1:240859696-240859718 AAAGCAGGTATCAATGAGAATGG - Intronic
1062858350 10:790820-790842 GCAGCAGGCATCCCTGAGCTGGG + Intergenic
1063208284 10:3855483-3855505 AAAGCAGCCATCCCCAAGCCAGG - Intergenic
1063927871 10:10998165-10998187 AATGAAGACATACCTGAGACAGG - Intergenic
1064981614 10:21172647-21172669 AAAGCAGGCAGCTCTGAAAATGG + Intronic
1065071822 10:22032595-22032617 AATAAAGACATCCCTGAGACTGG - Intergenic
1066194937 10:33090070-33090092 AATGAAGACATACCTGAGACTGG - Intergenic
1067798777 10:49342046-49342068 AAAAAAGGTATACCTGAGACTGG + Intergenic
1068187660 10:53607106-53607128 AATGCAGTCATCTCTGAGACTGG + Intergenic
1068221894 10:54056330-54056352 AAAAAAGGCATACCTGAGACTGG + Intronic
1068479002 10:57564689-57564711 AATAAAGGCATACCTGAGACTGG - Intergenic
1070457352 10:76630596-76630618 AAAGCAGGCATCCCTGTATGTGG - Intergenic
1070930418 10:80256929-80256951 AGAGGAGGCAAACCTGAGACAGG - Intergenic
1071707167 10:88011728-88011750 AATGAAGACATACCTGAGACTGG - Intergenic
1072958327 10:99906546-99906568 AGAGCAAGCACGCCTGAGACAGG - Intronic
1073864489 10:107786462-107786484 AAAAAAGACATACCTGAGACTGG - Intergenic
1074850633 10:117436816-117436838 ATAGGTGGCATCCCTGAGACTGG + Intergenic
1075216797 10:120543339-120543361 ACAGCAGGGAACCCTGAGACAGG - Intronic
1075269061 10:121033265-121033287 AGAGACGGCATCCCTGAGGCAGG + Intergenic
1075550510 10:123389328-123389350 AATAAAGGCATACCTGAGACTGG - Intergenic
1075722403 10:124595025-124595047 AATGAAGACATACCTGAGACTGG - Intronic
1076686729 10:132201547-132201569 CCAGCAGGCATCACTGAGATGGG + Intronic
1076798344 10:132809495-132809517 CAAGCAGGGATCCTTGGGACCGG + Intronic
1078095151 11:8292117-8292139 GAAGCAGTCTTCCCTGAGAGAGG - Intergenic
1079852628 11:25556022-25556044 AAAAAAGACATACCTGAGACTGG - Intergenic
1081230799 11:40583612-40583634 AAAGAACTCATCCCTGAGATGGG - Intronic
1081753113 11:45526125-45526147 AATAAAGGCATGCCTGAGACTGG - Intergenic
1082088379 11:48068579-48068601 AATGAAGACATACCTGAGACTGG - Intronic
1083049162 11:59761645-59761667 AAAGCAGGCTACCCTGAGAGAGG - Intronic
1083185962 11:61018071-61018093 AAAGCTGGGAGCCCTGAGTCAGG + Intronic
1083254131 11:61485959-61485981 AAAGCTAGAAACCCTGAGACTGG - Intronic
1086772905 11:90791410-90791432 GACGCAGACATACCTGAGACTGG - Intergenic
1088164452 11:106916443-106916465 AAAGCAGGTAGCCCTGGGCCTGG + Intronic
1088728705 11:112661779-112661801 AAAGAAGGCAGGCCTGAGCCAGG + Intergenic
1088762676 11:112947493-112947515 AATGAAGACATACCTGAGACCGG + Intergenic
1089743261 11:120599683-120599705 AAAGCTGGCAGCCTTGAAACTGG - Intronic
1090247141 11:125224544-125224566 AAATCAGGCCTCCCTCAGAAAGG + Intronic
1090321403 11:125846850-125846872 AATAAAGGCATACCTGAGACTGG + Intergenic
1090521855 11:127488456-127488478 AATACAGACATACCTGAGACTGG + Intergenic
1090556969 11:127886392-127886414 AAAAAAGACATACCTGAGACTGG + Intergenic
1090722624 11:129490249-129490271 AAAGCAGTCTTGCCTGAGACAGG - Intergenic
1091137232 11:133202725-133202747 GAAACAGGCATCACTGACACTGG + Intronic
1091232006 11:133994211-133994233 AAAGAAAGCATCTCTTAGACTGG - Intergenic
1092116352 12:6011414-6011436 AGGGCAGTGATCCCTGAGACTGG + Intronic
1092817753 12:12326136-12326158 AACCAAGGCATCCCGGAGACTGG + Exonic
1092876247 12:12850623-12850645 ATAGAAGACATACCTGAGACTGG + Intergenic
1093624398 12:21328218-21328240 AAGGAAGATATCCCTGAGACTGG - Intronic
1094753981 12:33444908-33444930 AATAAAGGCATACCTGAGACTGG + Intergenic
1095192875 12:39278353-39278375 AAAGTATGAGTCCCTGAGACTGG - Intergenic
1095296475 12:40532706-40532728 ACAGCAGGCATCACTGTGCCAGG + Intronic
1095483852 12:42663887-42663909 TAAGCAGGCATCACTGGTACTGG - Intergenic
1095640732 12:44482574-44482596 AATGAAGACATTCCTGAGACTGG + Intergenic
1095898424 12:47303754-47303776 ACAGCAAGCATCCCTGTGACTGG - Intergenic
1096228365 12:49883480-49883502 AAAGCAGGCATCCAGGGGAAGGG + Intronic
1098297952 12:69023279-69023301 CAAGCATGCATCACTGTGACTGG + Intergenic
1099176330 12:79427091-79427113 AATGAAGACATACCTGAGACTGG - Intronic
1100063023 12:90604711-90604733 AAAGAAGACATACCTGAGATTGG - Intergenic
1102212193 12:111135654-111135676 AAAGAATGCATCTCTGACACAGG + Intronic
1102592681 12:113968957-113968979 AATGAAGACATACCTGAGACTGG + Intergenic
1102749387 12:115279131-115279153 AAAACAGGCAGCCGTGAGGCTGG - Intergenic
1103962742 12:124619397-124619419 AAATCTTGCATCCCCGAGACAGG + Intergenic
1106468080 13:30030706-30030728 AATAAAGGCATACCTGAGACTGG + Intergenic
1108289665 13:48946478-48946500 AAAGCAAGCAACCCTGACTCTGG + Intergenic
1108819999 13:54336629-54336651 AAAGCAGATGTCCCTGGGACTGG - Intergenic
1108847817 13:54697331-54697353 AAAGCAGGCTGCCCTGAAAGTGG - Intergenic
1109181355 13:59217768-59217790 AAATCATGCATCCCTGAGGCTGG + Intergenic
1109475509 13:62876216-62876238 AAAGAAAACATACCTGAGACTGG + Intergenic
1109853586 13:68101121-68101143 AATAAAGGCATACCTGAGACTGG + Intergenic
1111841682 13:93457156-93457178 AATGAAGACATACCTGAGACTGG - Intronic
1112268976 13:97951002-97951024 AAAAAAGACATACCTGAGACTGG - Intergenic
1112931688 13:104747623-104747645 AATAAAGGCATACCTGAGACTGG - Intergenic
1113630992 13:111883779-111883801 AAACCAGGCATCACTAACACAGG + Intergenic
1115362078 14:32515044-32515066 AAAAAAGACATACCTGAGACTGG + Intronic
1117338375 14:54773985-54774007 AAAGAAGGGAGCCCTGGGACAGG + Intronic
1117968983 14:61233853-61233875 AAAAAAGACATACCTGAGACTGG - Intronic
1118668844 14:68100896-68100918 AATGAAGACATACCTGAGACTGG + Intronic
1120568883 14:86092947-86092969 AATAAAGACATCCCTGAGACTGG - Intergenic
1120746878 14:88160131-88160153 AAACCAGGCAAACCTGAGGCTGG - Intergenic
1121491888 14:94367049-94367071 AAAGCAAGCATCCCTCAGCCTGG + Intergenic
1121625681 14:95384091-95384113 ACAGGAGGCATTCCTGAGCCAGG + Intergenic
1121911024 14:97792670-97792692 TAGGCAGGCAGCCCTGATACTGG + Intergenic
1122363304 14:101180137-101180159 AAGGCCTGCATCCCTGAAACTGG + Intergenic
1122874878 14:104659421-104659443 GAAGCAGGGAGCCCTGGGACTGG - Intergenic
1124029465 15:25996841-25996863 AATAAAGGCATACCTGAGACTGG + Intergenic
1125025037 15:35021099-35021121 AATGCAGGGATGCATGAGACAGG - Intergenic
1125436754 15:39653865-39653887 GATGAAGGCATACCTGAGACTGG - Intronic
1125549047 15:40530706-40530728 AAAAAAGGAATACCTGAGACTGG - Intronic
1127268802 15:57382463-57382485 AAAGCAGAAATCCCTGTGATTGG - Intronic
1127538182 15:59910923-59910945 AGAGAGGGCATCCCTAAGACAGG - Intergenic
1128006751 15:64249643-64249665 AAAACTGGAATCTCTGAGACTGG - Intronic
1128062231 15:64742458-64742480 AAAGCTGGGTTCCCAGAGACTGG + Intronic
1129273443 15:74431393-74431415 AAAGCAGGGAACTCTGAGAGGGG - Intronic
1130653306 15:85774598-85774620 AAGTCAGGCCTTCCTGAGACTGG - Intronic
1131427483 15:92358309-92358331 AAAAAAGACATACCTGAGACTGG + Intergenic
1131558448 15:93419026-93419048 TAAGAAGGAATACCTGAGACTGG - Intergenic
1131592012 15:93760150-93760172 AAAGAAGGCTTCCCAGAGGCAGG - Intergenic
1131668590 15:94596018-94596040 AAAGCAGCCATCTCTGAAACGGG + Intergenic
1131732921 15:95300951-95300973 AAATCAGGGATCCCGGGGACAGG + Intergenic
1132659743 16:1055995-1056017 AAAGCAGGCAACCCTCAGCTCGG - Intergenic
1133438278 16:5799021-5799043 AATGAAGACATACCTGAGACTGG + Intergenic
1133655759 16:7862265-7862287 ACAGAAGGCCTCCCTGACACAGG + Intergenic
1135233979 16:20738823-20738845 TAAGCAGTATTCCCTGAGACAGG + Intronic
1135475413 16:22770319-22770341 AAAGTGGGCATCACTGAGAATGG + Intergenic
1135712362 16:24729147-24729169 AAAGAATGCATACCTGAGGCGGG - Intergenic
1137594314 16:49713788-49713810 AAAGATGCCATCCGTGAGACTGG + Intronic
1137760663 16:50937565-50937587 GATGAAGGCATACCTGAGACTGG - Intergenic
1138069718 16:53980841-53980863 AAAGCAACCATAACTGAGACAGG + Intronic
1138412724 16:56852603-56852625 AAAAAAGGCATCCCTGAGGTGGG - Intergenic
1138617471 16:58181441-58181463 CAAGCCTGCATCCTTGAGACAGG + Intronic
1139261849 16:65601764-65601786 AGAGCAGCCATGTCTGAGACAGG - Intergenic
1140026150 16:71292160-71292182 AATACAGACATACCTGAGACTGG + Intergenic
1140827962 16:78725295-78725317 AAAAAAGACATACCTGAGACTGG - Intronic
1141466959 16:84212614-84212636 AATGAAGACATACCTGAGACTGG - Intergenic
1141601177 16:85127225-85127247 AGAGCGGGCAGCCCTGAGCCTGG - Intergenic
1143001521 17:3798075-3798097 AATGCAGGCCTCCCAGAGAAGGG + Intronic
1143626366 17:8112382-8112404 TATGCAGCCATCCCTAAGACAGG + Intronic
1143831722 17:9657521-9657543 AAAGGAGACATACCTGAGACTGG + Intronic
1146929879 17:36769339-36769361 AAAGCTGGGACCCCTGAGACTGG - Intergenic
1150321611 17:64218854-64218876 AAACCAGGCCTCACTTAGACTGG + Intronic
1150994136 17:70296655-70296677 AAAGCAGGAAATCCTGTGACAGG + Intergenic
1151121437 17:71797244-71797266 AATGAAGACATACCTGAGACTGG - Intergenic
1151907196 17:77056339-77056361 CAGGGAGGCATCCCTGACACCGG - Intergenic
1152438077 17:80288292-80288314 AAAGGAGGCAGCTCTGAGCCCGG + Exonic
1153263053 18:3242496-3242518 AAAAAAGACATACCTGAGACTGG - Intergenic
1153348461 18:4053170-4053192 AATAAAGGCATACCTGAGACTGG + Intronic
1153841741 18:9014098-9014120 AAAGAAGGCATCTCTGTGACTGG + Intergenic
1154322828 18:13368403-13368425 AAAGCAGGCATCCCTGAGACAGG - Intronic
1155114833 18:22753888-22753910 AAAGCAGTCATCCCTCAAAGGGG + Intergenic
1155466953 18:26146814-26146836 AAAACAGAAATACCTGAGACTGG + Intronic
1156092336 18:33486925-33486947 AATCCAGGCATGCCTTAGACAGG - Intergenic
1158106451 18:53890253-53890275 AAAAAAGACATACCTGAGACTGG + Intergenic
1158744920 18:60188739-60188761 AATGAAGACATACCTGAGACTGG - Intergenic
1160058285 18:75507014-75507036 ACTGCAGTCATCCCTGAGAGAGG + Intergenic
1160096601 18:75878888-75878910 AATAAAGGCATACCTGAGACTGG - Intergenic
1160230390 18:77044277-77044299 AAAGACTGCATGCCTGAGACGGG + Intronic
1160303655 18:77710014-77710036 AATAAAGGCATACCTGAGACTGG + Intergenic
1161146942 19:2684551-2684573 ACAGCAGGCAATCCTGACACAGG + Intronic
1161780656 19:6289693-6289715 AAAGCAGGCCACCCTGAAAGTGG + Intergenic
1163322917 19:16585170-16585192 ACAGCAGGCACCCCTGGGGCTGG + Intronic
1163354750 19:16802960-16802982 AAAAAAGACATACCTGAGACTGG + Intronic
1163514869 19:17756678-17756700 ACAGGAGGCCTCCCTGAGTCTGG - Intronic
1164297756 19:23929318-23929340 AATGAAGACATACCTGAGACTGG + Intronic
1166236958 19:41463822-41463844 AAAGCAGGCAGCCCGGCGCCAGG - Intergenic
1167640713 19:50679695-50679717 TAAGGAGGCAGCCCTGAGAGGGG + Intronic
925171680 2:1754087-1754109 CAAGCAGGCATCCCGGGGAGGGG - Intergenic
925571882 2:5321215-5321237 AATGAAGACATACCTGAGACTGG - Intergenic
926269173 2:11352215-11352237 AAAGAAGACATACCTGAAACTGG + Intergenic
926526986 2:13992937-13992959 AATAAAGGCATACCTGAGACTGG + Intergenic
926544081 2:14217127-14217149 AATGAAGACATACCTGAGACTGG - Intergenic
928214481 2:29349939-29349961 AAGGCAGGAATCACTGAAACAGG + Intronic
928463938 2:31502490-31502512 AAAAAAGACATACCTGAGACTGG + Intergenic
929640069 2:43569130-43569152 GAAAAAGGCAACCCTGAGACGGG - Intronic
929643635 2:43606496-43606518 GAAGAAGGAATCCCTGGGACAGG + Intergenic
930075995 2:47406095-47406117 AAAAAAGACATACCTGAGACTGG - Intronic
930306262 2:49678216-49678238 AGAGAAGGGATGCCTGAGACTGG - Intergenic
930507901 2:52306448-52306470 AATGAAGACATACCTGAGACTGG - Intergenic
931982062 2:67704446-67704468 GAACCAGGCATCCCTTAGTCAGG - Intergenic
934081927 2:88475954-88475976 AATAAAGGCATACCTGAGACTGG - Intergenic
934144319 2:89076348-89076370 GAAACAGACATACCTGAGACTGG - Intergenic
934224928 2:90124200-90124222 GAAACAGACATACCTGAGACTGG + Intergenic
935026190 2:99279172-99279194 AAAGCAGGCTTCCCCAAGGCTGG + Intronic
935514077 2:104013193-104013215 GATGAAGGCATACCTGAGACTGG + Intergenic
936685261 2:114820505-114820527 AATGAAGACATACCTGAGACAGG + Intronic
937915635 2:127097470-127097492 GAAGCAGGCATGCATGGGACAGG + Intronic
938235518 2:129703208-129703230 AATACAGACATACCTGAGACTGG + Intergenic
938247152 2:129786624-129786646 AAAGCAGGTGTCCCTGAGGATGG + Intergenic
939278642 2:140034682-140034704 AAAGCAGTCAACCCAGAGAAGGG - Intergenic
939468372 2:142586999-142587021 AAGGCAGGCAGCCCTGTGGCAGG - Intergenic
939935193 2:148283257-148283279 AAAGTAGGTAACCCTGAGCCTGG + Intronic
940386917 2:153084781-153084803 AATGAAGACATACCTGAGACTGG - Intergenic
941253184 2:163193198-163193220 TTAGCAGGCATCATTGAGACCGG + Intergenic
941718602 2:168789272-168789294 AATGAAGACATACCTGAGACTGG + Intronic
941755655 2:169183002-169183024 AAAGCTGGCTTCCCTGATTCTGG - Intronic
942472767 2:176278839-176278861 AAAGCATGCATCCCTTTTACTGG - Intronic
942904855 2:181167911-181167933 AAAAAAGACATACCTGAGACTGG + Intergenic
944483288 2:200178731-200178753 AAAGAAGGCAAGCCTGAGATGGG - Intergenic
946402857 2:219477627-219477649 AAAGCAAGCAGGCCAGAGACTGG - Intronic
946600456 2:221354917-221354939 GAAGAAGACATACCTGAGACTGG + Intergenic
947540263 2:230972476-230972498 AAAAAAGACATACCTGAGACTGG - Intergenic
947908384 2:233783878-233783900 AAAGGATGCATAACTGAGACTGG - Intronic
947908673 2:233786251-233786273 AATGCAAACATACCTGAGACTGG - Intronic
948072298 2:235137783-235137805 AAAACAGGCCTCCTTGAGGCAGG - Intergenic
948074410 2:235154818-235154840 AATGAAGACATACCTGAGACTGG - Intergenic
948732846 2:239978067-239978089 CAAGCAGGGATCCCAGAGGCAGG - Intronic
1168916379 20:1491528-1491550 AAAGCAGGAAACCCTTTGACCGG - Intronic
1172029031 20:31968626-31968648 AAAGAAGGCAGCCCCGAGCCGGG + Exonic
1173120691 20:40286588-40286610 AAAGCAGGCAGAGCTGAGATTGG - Intergenic
1173132457 20:40407692-40407714 AAAGAAGGCATCTCTGGCACCGG + Intergenic
1173649559 20:44654279-44654301 AAAAAAGACATACCTGAGACTGG + Intergenic
1174785599 20:53429630-53429652 AATGAAGACATACCTGAGACTGG - Intronic
1174917856 20:54672047-54672069 AGAGAAGGCAGCCCTGACACTGG - Intergenic
1175012919 20:55757993-55758015 AAGGCAGGCTTGCCTGAGAGAGG - Intergenic
1177039039 21:16083496-16083518 TAAAAAGACATCCCTGAGACTGG + Intergenic
1177491286 21:21829309-21829331 AAAGCAGACATCTCAGAGAGGGG - Intergenic
1177728760 21:25000691-25000713 GCTGCAGACATCCCTGAGACTGG - Intergenic
1177767637 21:25476239-25476261 AAAGAAGAAATACCTGAGACTGG - Intergenic
1177938731 21:27382509-27382531 AATGCATGCATCCCAGTGACTGG - Intergenic
1178430864 21:32517736-32517758 AAAGCAAGCTTCCCTTACACAGG + Intergenic
1179299244 21:40091640-40091662 AATAAAGGCATGCCTGAGACTGG + Intronic
1180567770 22:16689900-16689922 AGGGCAGTGATCCCTGAGACTGG + Intergenic
1181094374 22:20495678-20495700 CAAGCAGGCATCGCTGGGCCGGG - Intronic
1183206745 22:36424718-36424740 AGGGTAGGCATCCCTGAGAAGGG - Intergenic
1183479749 22:38057078-38057100 AACGAAAGCATCCCTGAGCCGGG - Intronic
950284852 3:11736711-11736733 AATGCTGGCATCCCTGGGACTGG + Intergenic
950433545 3:12965645-12965667 CAAGCAGGCTTCCCTGAAGCTGG + Intronic
952291750 3:32023458-32023480 AATAAAGGCATACCTGAGACAGG - Intronic
952684271 3:36131295-36131317 GAAGCAGGCAGCCCTGAAAGTGG + Intergenic
952707456 3:36393708-36393730 AAAGCAGCCATCCATGAACCAGG + Intronic
954237957 3:49271555-49271577 AAAGCAGGCATTCCTGCCCCAGG + Intronic
954774535 3:53004817-53004839 GAAGCAGCCATCCCTGGAACCGG + Intronic
955023885 3:55148398-55148420 AAGCCAGGCATCCCGGAGCCTGG + Intergenic
955716620 3:61836456-61836478 AAAGCTGGCCTCCAGGAGACAGG - Intronic
955729207 3:61966280-61966302 ACAGCAGGCAACACTGATACAGG + Intronic
955827270 3:62961731-62961753 AATGCAGGCACTCCTGAGAAAGG + Intergenic
956948117 3:74247793-74247815 AAAAAAGACATACCTGAGACTGG + Intergenic
957435413 3:80168805-80168827 AATAAAGGCATACCTGAGACTGG + Intergenic
957760594 3:84550043-84550065 AATGAAGACATACCTGAGACTGG - Intergenic
957963771 3:87295406-87295428 AAAAAAGGCATACCTGAGACTGG + Intergenic
958758261 3:98275500-98275522 AAAGAAGGCAGGCCTGGGACGGG + Intergenic
959851164 3:111088408-111088430 AATGAAGGAATACCTGAGACTGG - Intronic
960257622 3:115527669-115527691 AATAAAGACATCCCTGAGACTGG - Intergenic
960583110 3:119296981-119297003 AAAGCAGACAGCCCTGCTACAGG + Intronic
960946648 3:122971447-122971469 AAAGCAGCCAGCCTTGAGAAGGG + Intronic
960960651 3:123068006-123068028 ACTCCAGGCATCCCTGAGAGAGG + Intronic
961722689 3:128907109-128907131 ACAGGAGGCAGGCCTGAGACAGG + Intronic
962367794 3:134797275-134797297 AACCCAGGCATCCCTGCGCCAGG - Intronic
964403257 3:156321243-156321265 ACAGCAGCCATTCTTGAGACAGG - Intronic
965013548 3:163127126-163127148 AATAAAGACATCCCTGAGACTGG + Intergenic
965354291 3:167655022-167655044 AATGAAGACATACCTGAGACTGG + Intergenic
966002767 3:174970929-174970951 AGATGAGGCATACCTGAGACTGG + Intronic
967126172 3:186426705-186426727 AAAGCACTCATCCCTCAGAGGGG - Intergenic
967531168 3:190550085-190550107 AAAGCAGGCACCCATGAAACAGG + Intronic
969029319 4:4198653-4198675 CAAGCAGGCATGCAGGAGACAGG + Intronic
969163356 4:5280933-5280955 AAAAAAGACATACCTGAGACTGG + Intronic
969229820 4:5822104-5822126 AAATCCGACATTCCTGAGACAGG + Intronic
970202771 4:13626853-13626875 TAAGGAGGCAAACCTGAGACAGG - Intronic
970796085 4:19915178-19915200 AAAGAAGGCAGCCATGTGACTGG - Intergenic
974353875 4:60786695-60786717 AAAGGAGGCATCCCAGAGTAAGG + Intergenic
974432630 4:61817640-61817662 AATAAAGGCATACCTGAGACTGG + Intronic
974575554 4:63715563-63715585 TAAAAAGGCATACCTGAGACTGG + Intergenic
974663994 4:64934887-64934909 AAGACAGTCATCCCTGAAACAGG - Intergenic
976969591 4:91089377-91089399 AAGGCAGGCAGCCCAGAGCCAGG - Intronic
978368940 4:108011271-108011293 AATGAAGACATGCCTGAGACTGG + Intronic
980241532 4:130183688-130183710 AATGAAGACATACCTGAGACTGG + Intergenic
980435547 4:132767473-132767495 TAAAAAGGCATACCTGAGACTGG + Intergenic
980560973 4:134475352-134475374 AAAGCCGGCAGCTCTGAGAGGGG + Intergenic
980859453 4:138481970-138481992 AAGGCAGACATCCCTGATCCTGG + Intergenic
981335882 4:143568564-143568586 AATGAAGACATACCTGAGACCGG + Intergenic
982098121 4:151941996-151942018 AATGAAGACATACCTGAGACTGG - Intergenic
982324850 4:154119757-154119779 AAAGCTGGCACCCCAGAGACTGG + Intergenic
982708403 4:158735946-158735968 AAAAAAGACATCCGTGAGACTGG + Intergenic
983661798 4:170136459-170136481 AAACCACCCATCCCTGAGGCTGG - Intergenic
984010350 4:174363827-174363849 AATAAAGGCATACCTGAGACTGG + Intergenic
985708591 5:1415467-1415489 CAAGCAGGCTTCACTGAGAGTGG - Intronic
986316870 5:6595203-6595225 AATACAGACATACCTGAGACTGG - Intergenic
986318548 5:6608700-6608722 AAAGCACGCGTCTCTAAGACAGG + Intronic
987875757 5:23678627-23678649 AGAACAGTGATCCCTGAGACAGG + Intergenic
988004930 5:25397417-25397439 AATACAGACATACCTGAGACTGG + Intergenic
989096928 5:37790462-37790484 AAAAAAGTCATACCTGAGACAGG + Intergenic
989213990 5:38884850-38884872 GAACCAGGCATCCAGGAGACTGG - Intronic
990077722 5:51872263-51872285 AATACAGACATACCTGAGACTGG - Intergenic
990755460 5:59064452-59064474 AAAGCACGCAGCCCTGATGCTGG + Intronic
991193897 5:63909230-63909252 AAAGCAGGCACACCTGAGAAGGG - Intergenic
992583106 5:78202262-78202284 AATAAAGACATCCCTGAGACTGG - Intronic
993733946 5:91453398-91453420 AAAGCAGGCCACACAGAGACAGG - Intergenic
994542432 5:101116872-101116894 AACAAAGGCATACCTGAGACTGG - Intergenic
996591701 5:125155330-125155352 AATGAAGACATACCTGAGACTGG + Intergenic
997049439 5:130362422-130362444 AAAGCAGGTATGCGTGAGATTGG + Intergenic
997483588 5:134209251-134209273 GAAGCAACCATCCCTCAGACCGG + Intronic
999021725 5:148173352-148173374 AAAACAAACATCCCTGAGTCCGG + Intronic
1001077595 5:168642097-168642119 AAAAAAGGCATACCTGAGACTGG - Intergenic
1001710177 5:173772134-173772156 AAATCAGGAAGCCCTGAGACAGG + Intergenic
1002572488 5:180150653-180150675 AGAGAGGGCATCCCAGAGACAGG - Intronic
1003513089 6:6797682-6797704 TATGAAGGCATACCTGAGACTGG - Intergenic
1004107206 6:12677021-12677043 AATGAAGACATACCTGAGACTGG - Intergenic
1004286060 6:14322101-14322123 GATGCAGGCTGCCCTGAGACAGG + Intergenic
1004321254 6:14633386-14633408 ACAGCAGGCCTCCCGGGGACTGG - Intergenic
1004489528 6:16100967-16100989 AACAAAGGCATACCTGAGACTGG - Intergenic
1004790627 6:19022304-19022326 AAAAGAGGTATCCCTGAGTCAGG - Intergenic
1005662729 6:28015764-28015786 TAAACAGGAATCCCTCAGACTGG - Intergenic
1005948648 6:30614740-30614762 AAAACAGGCAAACCTAAGACTGG - Intronic
1007432510 6:41785000-41785022 GAAGCAGGAAGCCCTGGGACAGG + Exonic
1007610460 6:43145604-43145626 AAAGCAGGCATCCAAGAGCAGGG - Intronic
1008337694 6:50326249-50326271 AAAAAAGACATACCTGAGACTGG + Intergenic
1008578913 6:52887704-52887726 AAAGCAGGCATTCCAGTGCCAGG + Intronic
1009545868 6:65019768-65019790 AATAAAGACATCCCTGAGACTGG + Intronic
1011288365 6:85749301-85749323 AAAGGAGGAAACCCTGAGATGGG + Intergenic
1012280890 6:97327357-97327379 AATAAAGACATCCCTGAGACTGG - Intergenic
1012327888 6:97946186-97946208 GAAGCAGCCATCACTGAGGCAGG + Intergenic
1012514087 6:100038679-100038701 AATGAAGACATACCTGAGACTGG - Intergenic
1012529699 6:100220715-100220737 AGAGCTGGCATCCCTGGAACGGG - Intergenic
1012832971 6:104228884-104228906 AATAAAGGCATACCTGAGACTGG - Intergenic
1012856517 6:104508296-104508318 AGAGCAGGCATCACTGAGGGTGG + Intergenic
1013890632 6:115022068-115022090 AATAAAGACATCCCTGAGACTGG + Intergenic
1015308403 6:131736282-131736304 AATAAAGGCATACCTGAGACTGG + Intronic
1015830262 6:137361160-137361182 AAACCAGGCATCCCTCAGAAAGG - Intergenic
1015853101 6:137594552-137594574 AATGAAGACATACCTGAGACTGG + Intergenic
1015877135 6:137834115-137834137 AAAAAAGACATACCTGAGACTGG - Intergenic
1016254852 6:142092617-142092639 AAAACAGTGATCCCTAAGACAGG + Intergenic
1016270034 6:142278140-142278162 AATGAAGACATACCTGAGACTGG + Intergenic
1016517751 6:144914295-144914317 GAAAAAGGCATACCTGAGACTGG - Intergenic
1017121918 6:151032183-151032205 TATAAAGGCATCCCTGAGACTGG + Intronic
1017933738 6:158985184-158985206 CACACAGGCACCCCTGAGACAGG - Intronic
1018026869 6:159813747-159813769 CAAGCAGGCATCACTGTGAATGG - Intronic
1018488525 6:164268331-164268353 AATAAAGGCATACCTGAGACTGG + Intergenic
1018705365 6:166460275-166460297 CAGGCAGGCAGCTCTGAGACCGG - Intronic
1019379599 7:713908-713930 AATGCAGGTCTGCCTGAGACGGG - Intronic
1019878872 7:3841066-3841088 AAAACGGGCATCCCTGGGATTGG - Intronic
1020471211 7:8537319-8537341 AATACAGGCATACTTGAGACTGG + Intronic
1021165540 7:17335715-17335737 AAAGCAGGCGTGCATTAGACTGG - Exonic
1021951614 7:25780455-25780477 TCAGCAGGCATCTCTGAGCCTGG - Intergenic
1024215761 7:47246707-47246729 ACATCAGCCATCTCTGAGACTGG - Intergenic
1024279759 7:47709571-47709593 GGAGAAGGCATCCCTGAGTCTGG + Intronic
1026307404 7:69154044-69154066 AATAAAGACATCCCTGAGACTGG + Intergenic
1026349060 7:69499780-69499802 AAAAAAGACATACCTGAGACTGG - Intergenic
1026651733 7:72221896-72221918 AAAGAAGAAATACCTGAGACTGG + Intronic
1026996001 7:74617199-74617221 GCAGCAGGCATCCAGGAGACCGG + Intergenic
1028679301 7:93507078-93507100 AATGAAGACATACCTGAGACTGG - Intronic
1028918350 7:96284866-96284888 AATAAAGGCATACCTGAGACTGG - Intronic
1029442041 7:100592264-100592286 AAAAAAGACATACCTGAGACCGG + Intronic
1030425155 7:109367334-109367356 AATAAAGGCATACCTGAGACTGG - Intergenic
1030523528 7:110627465-110627487 AAGGAAAGCATCCCTGAGAAGGG + Intergenic
1031238828 7:119211971-119211993 AATGAAGACATACCTGAGACTGG - Intergenic
1032187477 7:129739651-129739673 CAAGCAGGAAAACCTGAGACCGG + Intronic
1033032308 7:137838933-137838955 AAAGCAGGCATCATCAAGACAGG + Intronic
1033836767 7:145323024-145323046 AATTAAGGCATACCTGAGACTGG - Intergenic
1034437019 7:151067379-151067401 AAAGGTGGCATCCCTGGGCCCGG - Intronic
1038460703 8:27714177-27714199 AAAAAAGGAATACCTGAGACTGG - Intergenic
1038820067 8:30943981-30944003 AAAAAAGACATACCTGAGACTGG + Intergenic
1040694608 8:49980462-49980484 AAAGCAGGAAGCCCTGGGGCAGG - Intronic
1040803819 8:51372008-51372030 GAAGCAGGCGTCCCTGAGCCGGG - Exonic
1040945166 8:52876717-52876739 TATGAAGGCATACCTGAGACTGG + Intergenic
1041345662 8:56894976-56894998 AAATCAGTCATTCTTGAGACAGG - Intergenic
1043102945 8:76069340-76069362 CAAGAAGGCATCCATGTGACAGG - Intergenic
1043385807 8:79747030-79747052 AATGAAGACATACCTGAGACTGG + Intergenic
1044141378 8:88657839-88657861 AAAACATGCATGCCTGAGAGTGG - Intergenic
1044321165 8:90803278-90803300 ACACCAGGCATCCCTGGGGCTGG - Intronic
1044365661 8:91342249-91342271 AAAGAAGGCCTCCCTGAGAAAGG - Intronic
1044700890 8:94964445-94964467 AAAGGAGGAATACCCGAGACTGG + Intronic
1046477972 8:114773888-114773910 AATAAAGGCATACCTGAGACTGG + Intergenic
1047121102 8:121906522-121906544 AAGAAAGGCATACCTGAGACTGG + Intergenic
1047607233 8:126487665-126487687 AAAAAAGGCATAACTGAGACCGG - Intergenic
1048147503 8:131860023-131860045 AAAGCAGACATCTTTGAGACCGG - Intergenic
1048700437 8:137082484-137082506 AAAGAAGACATACCTGAGACTGG - Intergenic
1048916986 8:139194629-139194651 CAGGCAGGCTTCCCTGGGACAGG - Intergenic
1049509694 8:143021273-143021295 ACTGGAGGCTTCCCTGAGACAGG + Intronic
1050879901 9:10686435-10686457 AAAACTGGCTTTCCTGAGACTGG + Intergenic
1050903955 9:10980469-10980491 AATGAAGACATACCTGAGACTGG + Intergenic
1050945299 9:11510109-11510131 AATGAAGGCATTCCTGAGACTGG - Intergenic
1051594320 9:18809219-18809241 AAAGCATGCATCCCTGTGTGTGG - Intronic
1051644283 9:19252065-19252087 AATAAAGGCATACCTGAGACTGG + Intronic
1055170638 9:73254076-73254098 AATAAAGGCATACCTGAGACTGG - Intergenic
1055567967 9:77588019-77588041 GAAGCAGACATCACTGAGACAGG - Intronic
1057464209 9:95297221-95297243 AAAGGAGGCATCCCTGATTTGGG - Intronic
1057804698 9:98211784-98211806 AAAAAAGGAATCCCTGAAACAGG - Intronic
1058752365 9:108051885-108051907 AAAGCAGGGATCCCTAGGATGGG + Intergenic
1058953704 9:109926545-109926567 ATGGCAGGCTTCCCTGAGTCTGG + Intronic
1058963381 9:110013257-110013279 AAAGCAAACATCAGTGAGACAGG + Intronic
1059884539 9:118731016-118731038 AAAGCAGGCTTTCCTGAGGAAGG - Intergenic
1062040529 9:134402338-134402360 AGGGCCGGCATCCCTGAGAGGGG - Intronic
1062429096 9:136519096-136519118 CATCCAGGCATCCCTGTGACTGG + Intronic
1062642606 9:137528231-137528253 AGAGCAGGAATCCATGAGATTGG - Intronic
1185872668 X:3677006-3677028 AATGAAGACATACCTGAGACTGG - Intronic
1186069903 X:5808378-5808400 AATACAGACATACCTGAGACTGG + Intergenic
1186449232 X:9658206-9658228 AATACAGACATACCTGAGACTGG - Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1187135681 X:16545142-16545164 ACAGCTGGCATCTCTGAGATGGG - Intergenic
1187667224 X:21627502-21627524 AAAAAAGACATACCTGAGACTGG + Intronic
1187734562 X:22290619-22290641 TATGAAGACATCCCTGAGACTGG - Intergenic
1187931469 X:24297273-24297295 AATAAAGGCATACCTGAGACTGG + Intergenic
1188424071 X:30025627-30025649 AAAAAAGACATACCTGAGACTGG - Intergenic
1189433208 X:40968090-40968112 AAAGAAGACATACCCGAGACTGG + Intergenic
1191715181 X:64189421-64189443 ATAGCATGCATCCTTGACACAGG - Exonic
1193013492 X:76705874-76705896 TATGAAGGCATACCTGAGACTGG + Intergenic
1194034680 X:88855342-88855364 AATGAAGACATACCTGAGACTGG - Intergenic
1194619968 X:96158915-96158937 AATACAGACATACCTGAGACTGG - Intergenic
1195230940 X:102846187-102846209 AAAGCAGGCATCACTTAGATGGG - Intergenic
1198998528 X:142605299-142605321 AATGCAGGCATCACAGAGACAGG - Intergenic
1199027731 X:142960150-142960172 AATGAAGACATACCTGAGACTGG + Intergenic
1199228828 X:145410671-145410693 AATAGAGGCATACCTGAGACTGG - Intergenic
1200008592 X:153104639-153104661 AATACAGACATACCTGAGACTGG - Intergenic
1200207668 X:154328967-154328989 CTAGCAGGCATCCCTTAGGCAGG - Intronic
1200683832 Y:6243610-6243632 AACTCAGGCATCCCTGTTACCGG - Intergenic
1201048803 Y:9910776-9910798 AACTCAGGCATCCCTGTTACCGG + Intergenic
1201449955 Y:14101039-14101061 GAAAAAGGCATGCCTGAGACTGG - Intergenic
1201630711 Y:16069295-16069317 AAAGCAGGCACCTCTTAGAAAGG + Intergenic