ID: 1154322957

View in Genome Browser
Species Human (GRCh38)
Location 18:13369190-13369212
Sequence ACCACTTACTCACCTTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154322946_1154322957 30 Left 1154322946 18:13369137-13369159 CCCCAGGCTGAGGCCGGGCTCAC No data
Right 1154322957 18:13369190-13369212 ACCACTTACTCACCTTCTTAGGG No data
1154322948_1154322957 28 Left 1154322948 18:13369139-13369161 CCAGGCTGAGGCCGGGCTCACAG No data
Right 1154322957 18:13369190-13369212 ACCACTTACTCACCTTCTTAGGG No data
1154322947_1154322957 29 Left 1154322947 18:13369138-13369160 CCCAGGCTGAGGCCGGGCTCACA No data
Right 1154322957 18:13369190-13369212 ACCACTTACTCACCTTCTTAGGG No data
1154322953_1154322957 17 Left 1154322953 18:13369150-13369172 CCGGGCTCACAGGCAGGGGACGT No data
Right 1154322957 18:13369190-13369212 ACCACTTACTCACCTTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154322957 Original CRISPR ACCACTTACTCACCTTCTTA GGG Intronic